ID: 1080636449

View in Genome Browser
Species Human (GRCh38)
Location 11:34128069-34128091
Sequence GAGCCACTGCACCTGGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3852
Summary {0: 1, 1: 21, 2: 267, 3: 1054, 4: 2509}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080636449_1080636460 27 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636460 11:34128119-34128141 GCCGAGGCAGGCGGATCACAAGG 0: 1280
1: 10436
2: 38399
3: 59352
4: 63674
1080636449_1080636458 15 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636458 11:34128107-34128129 GCACATTGGGAGGCCGAGGCAGG 0: 363
1: 86688
2: 223496
3: 237940
4: 242372
1080636449_1080636454 5 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636454 11:34128097-34128119 TGTAATCCCAGCACATTGGGAGG 0: 1586
1: 294266
2: 268199
3: 208153
4: 227662
1080636449_1080636459 18 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636459 11:34128110-34128132 CATTGGGAGGCCGAGGCAGGCGG 0: 138
1: 28327
2: 118187
3: 169127
4: 170076
1080636449_1080636452 2 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636452 11:34128094-34128116 ACCTGTAATCCCAGCACATTGGG 0: 449
1: 74928
2: 305527
3: 264699
4: 238946
1080636449_1080636456 11 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636456 11:34128103-34128125 CCCAGCACATTGGGAGGCCGAGG 0: 487
1: 117495
2: 263892
3: 218538
4: 229296
1080636449_1080636451 1 Left 1080636449 11:34128069-34128091 CCTGTAGCCAGGTGCAGTGGCTC 0: 1
1: 21
2: 267
3: 1054
4: 2509
Right 1080636451 11:34128093-34128115 CACCTGTAATCCCAGCACATTGG 0: 437
1: 71218
2: 207369
3: 281506
4: 255107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080636449 Original CRISPR GAGCCACTGCACCTGGCTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr