ID: 1080638293

View in Genome Browser
Species Human (GRCh38)
Location 11:34142582-34142604
Sequence AGGTGTGACCTGGAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 232}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080638293_1080638300 -4 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638300 11:34142601-34142623 ACCTCGGGTCCTTCCAGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 122
1080638293_1080638310 29 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638310 11:34142634-34142656 TGGATGAGCAGGCCCTTTAATGG 0: 1
1: 0
2: 0
3: 8
4: 98
1080638293_1080638304 -1 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638304 11:34142604-34142626 TCGGGTCCTTCCAGGAGTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 111
1080638293_1080638299 -9 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638299 11:34142596-34142618 GTCACACCTCGGGTCCTTCCAGG 0: 1
1: 0
2: 1
3: 2
4: 93
1080638293_1080638302 -3 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638302 11:34142602-34142624 CCTCGGGTCCTTCCAGGAGTGGG 0: 1
1: 1
2: 2
3: 8
4: 143
1080638293_1080638307 9 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638307 11:34142614-34142636 CCAGGAGTGGGGGTGCCGATTGG 0: 1
1: 0
2: 2
3: 14
4: 197
1080638293_1080638308 18 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638308 11:34142623-34142645 GGGGTGCCGATTGGATGAGCAGG 0: 1
1: 0
2: 1
3: 4
4: 67
1080638293_1080638303 -2 Left 1080638293 11:34142582-34142604 CCCCAAGGCTCCAGGTCACACCT 0: 1
1: 0
2: 3
3: 30
4: 232
Right 1080638303 11:34142603-34142625 CTCGGGTCCTTCCAGGAGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080638293 Original CRISPR AGGTGTGACCTGGAGCCTTG GGG (reversed) Intronic
900635482 1:3662809-3662831 AGGTCTGTCCTGGGGCCTGGTGG - Intronic
901790225 1:11650038-11650060 TGGTGTGACGTGGAGCATGGTGG - Exonic
901872298 1:12145196-12145218 GGGTGTGGGCTGGAGTCTTGGGG - Intergenic
902089162 1:13889304-13889326 AGGTGACAGCTGGAGCCTTCAGG - Intergenic
903393572 1:22982259-22982281 AGGAGTAGCCTGGAGCCATGAGG + Intergenic
903640620 1:24857465-24857487 AGGTAAGACCAGGAGCCTTGAGG + Intergenic
903882240 1:26518949-26518971 ACCTCTGACCTGGAGCCTGGGGG - Intergenic
904001726 1:27342545-27342567 GGGTGTCCCCTGGTGCCTTGGGG - Intronic
904431328 1:30466333-30466355 AGGTGAGAGCTGGAGCCATGTGG - Intergenic
905215189 1:36401686-36401708 AGGGGTGGCCTGAAGCCTGGGGG - Intergenic
905347821 1:37323413-37323435 AGGGGCAACCTGGAGACTTGGGG - Intergenic
909359434 1:74743881-74743903 AGGTTTGCCCTGGAGCCTGTAGG + Intronic
913111802 1:115663871-115663893 AGGGATGAGCTGGAGCCTTGTGG + Exonic
913215004 1:116612872-116612894 AGCTCTGGCCTGGAGCCTGGTGG + Intronic
913549487 1:119903343-119903365 TGAGGTCACCTGGAGCCTTGAGG + Intergenic
914855323 1:151346388-151346410 AGGAGTGCCCTGGGGCCTTCTGG - Intronic
915345206 1:155193652-155193674 AGTGGTCACCGGGAGCCTTGCGG + Intergenic
915361436 1:155288360-155288382 AGGTTTGGCCAGGAGCCCTGAGG - Exonic
916295779 1:163217929-163217951 AGGTAGGACATGGAGCCATGAGG + Intronic
916725048 1:167516138-167516160 AGCTCTGACATGCAGCCTTGGGG - Intronic
917299885 1:173561975-173561997 AGCTGTGAGCTGGATCCTGGTGG - Intronic
920932613 1:210402640-210402662 AGGTGTCACCTAGAGCTTTGGGG + Intronic
922483541 1:225956073-225956095 AGGTGGTACCTGGAGCCATGGGG + Intergenic
922616019 1:226961603-226961625 GGGTGGGACCTGGAGCTCTGGGG + Intronic
923078644 1:230632965-230632987 AGGTGTTACTTAAAGCCTTGAGG + Intergenic
923917967 1:238530224-238530246 AGGGATGACCTGAAGCCTGGGGG - Intergenic
1063184547 10:3638843-3638865 GGATGTGACCTTGGGCCTTGTGG + Intergenic
1065201466 10:23316965-23316987 AGGGGTGGCCTGAAGCCTGGGGG - Exonic
1067428766 10:46228400-46228422 AGCTGTGGCCTGGAGCCCTTCGG + Intergenic
1069160310 10:65084421-65084443 AGGGATGGCCTGCAGCCTTGTGG - Intergenic
1070332625 10:75429298-75429320 AGGTCTTAGGTGGAGCCTTGTGG + Intergenic
1070753007 10:78974859-78974881 GGCTTTGACCTGGAGCCTGGTGG - Intergenic
1070791335 10:79191243-79191265 AGGTGGGATTTGGAGCCTTGGGG + Intronic
1070795734 10:79215255-79215277 AGCTCTGACCTGAAGCCCTGTGG + Intronic
1071283833 10:84126099-84126121 AGGTGTGCCCTGCCCCCTTGTGG - Intergenic
1073082550 10:100869065-100869087 AGTTCTGACCTGGTGCCTGGTGG - Intergenic
1073439290 10:103543252-103543274 AGGTGTGTCCTGGAACATGGGGG - Intronic
1073563399 10:104515963-104515985 AGGTGTCACCTGGAACCATGGGG + Intergenic
1076032365 10:127170345-127170367 GGGTGTTACCTGCAGGCTTGGGG - Intronic
1077445731 11:2589791-2589813 AGGTCTGCCCTGGAGCAGTGTGG - Intronic
1080638293 11:34142582-34142604 AGGTGTGACCTGGAGCCTTGGGG - Intronic
1083473465 11:62900198-62900220 AGATGTGAGGTGGAGCCATGAGG + Intergenic
1083610731 11:64002990-64003012 AGGGTTGAGCTGGAGCCTGGAGG - Intronic
1085040343 11:73323158-73323180 AGGTGTGGCCTGGAGCTCTGGGG - Intronic
1086391991 11:86374818-86374840 AGGGGTGAGCTGCAGCCTCGAGG - Intronic
1086966261 11:93031465-93031487 AGGTATGAGTAGGAGCCTTGCGG - Intergenic
1087338931 11:96878302-96878324 AGGGGTGGCCTGAAGCCTGGGGG - Intergenic
1087542232 11:99534101-99534123 AGGTGTGAAGTAGAGCCGTGTGG - Intronic
1088211256 11:107459147-107459169 AGGTGTGTCCTGGTTCCTAGAGG + Intergenic
1089127835 11:116189946-116189968 AGATTTGGCCTGGAGCCTGGAGG + Intergenic
1090277801 11:125431967-125431989 AGGGATGAGCTGGAGCCTGGTGG - Exonic
1090762461 11:129849445-129849467 TGGTATCACCTGGAGCCTTGGGG - Intronic
1091885923 12:4016993-4017015 AGATGTCACCTGGGGCCTGGTGG + Intergenic
1092165016 12:6337105-6337127 AGGGCTGACCTGGAGCATTCTGG - Intronic
1092386298 12:8038110-8038132 AGGTGTTTCCTTCAGCCTTGTGG + Intronic
1096353348 12:50918247-50918269 AAGTGTGACCTGTAACCATGTGG + Intergenic
1096670036 12:53193122-53193144 CGGAGGTACCTGGAGCCTTGGGG - Exonic
1097224836 12:57471116-57471138 AGGTTCCACCTAGAGCCTTGGGG - Exonic
1101040151 12:100747345-100747367 AGGTGTTACCTGTAGTCTTAAGG - Intronic
1101638971 12:106571837-106571859 AGGTGAGACCGGGAGGCTAGAGG - Intronic
1102963912 12:117111868-117111890 AGGTGGGGCCTGGAGCCCTGAGG + Intergenic
1104866514 12:131959077-131959099 AAGTGTGAACTGGAACATTGCGG + Intronic
1105218736 13:18306349-18306371 AGCTCTGGCCTGGAGCCTGGTGG + Intergenic
1105793270 13:23823971-23823993 AGGTGTCAACTGTATCCTTGGGG + Intronic
1106453098 13:29902285-29902307 AGGTTTCAACTGGAGGCTTGAGG - Intergenic
1106506150 13:30372177-30372199 AGGTGTGTCCCGATGCCTTGTGG - Intergenic
1107064767 13:36201162-36201184 AGGTGTCTCCTGGAGCCATGGGG - Intronic
1107426364 13:40297092-40297114 AGAACTGACCTGAAGCCTTGAGG + Intergenic
1108492274 13:50993515-50993537 AGGTGTGACCTGCAGTCCAGCGG - Intergenic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1111795106 13:92909499-92909521 AGGTGTGAAATGGAGACTGGAGG + Intergenic
1113447498 13:110380620-110380642 GGGTGTGACGTAGAGCCCTGTGG - Intronic
1113553189 13:111209074-111209096 AGCTGGGACCTGGAGACTTAGGG + Intronic
1113826009 13:113254203-113254225 GGGTCTGACCTGGAGGCATGTGG + Intronic
1114694505 14:24613861-24613883 AGGTGAGAGCTGGAGCCAGGAGG - Intergenic
1115316354 14:32028844-32028866 TGTTGTTCCCTGGAGCCTTGTGG - Intergenic
1119044772 14:71308875-71308897 AGCTGTGACCAGGAGCCTGGAGG - Intergenic
1119704330 14:76774538-76774560 AGGGGTCACCTGGTGGCTTGTGG + Intronic
1119718062 14:76872862-76872884 AGGGGTGGCCTGGAGGGTTGGGG - Intergenic
1119877100 14:78070233-78070255 TAGTGAGACCTGGAGCATTGGGG - Intergenic
1120890407 14:89485858-89485880 AGGCGTGGCATTGAGCCTTGAGG - Intronic
1121122185 14:91383058-91383080 AGGGGTGCACTGGAGCCCTGGGG - Intronic
1121309327 14:92926697-92926719 AGGTATGAGCTGGAGGCTAGGGG + Exonic
1121319709 14:92984716-92984738 AGGTGCCACCTGGTGCCCTGTGG + Intronic
1122170856 14:99873838-99873860 AGGTGGGTCCTGGTCCCTTGTGG + Intronic
1122178850 14:99939980-99940002 AGATGTGGCTTGGAGCCTGGAGG - Exonic
1122531643 14:102431982-102432004 AGGGGTGGCCTGGAGCCCAGGGG - Exonic
1124348189 15:28936414-28936436 AGGTCTGTCCCGGAGCCATGTGG + Intronic
1124386383 15:29211333-29211355 ATGTGTGCCCTGCAGCCCTGAGG + Intronic
1124637337 15:31373584-31373606 GGGTGTGGCCTGGAGCCTCCAGG - Exonic
1125719408 15:41838193-41838215 AGGTGGGACCTGGTGCCCTGGGG + Intronic
1125776124 15:42215684-42215706 AGGTGTGACGTGACACCTTGTGG - Intronic
1126297014 15:47150939-47150961 AGGTGGAGCCTGGAGCCTGGTGG - Intergenic
1126696991 15:51334841-51334863 AGGTATGACCTGGGGCCAGGTGG - Intronic
1127868272 15:63048811-63048833 AGGTGCGCCCTGGAGGCGTGGGG - Intronic
1128687892 15:69700396-69700418 AGGTGTGTGCAGGAGCCTTGTGG + Intergenic
1129999963 15:80037672-80037694 AGCAATGACCTGGAGCTTTGAGG - Intergenic
1130669421 15:85898534-85898556 GGGTGTGAGCTGGAGCCTGAGGG + Intergenic
1130784716 15:87083442-87083464 AGGTTTCTCCTGGAGCCTCGAGG + Intergenic
1132335098 15:101043179-101043201 GGGTGTCACCTGGAGACTTCTGG + Intronic
1132607382 16:799284-799306 AGGCGGGAGCTGGGGCCTTGTGG - Intronic
1133583041 16:7165217-7165239 AGGTGTGACATGCAGTCGTGAGG + Intronic
1135292352 16:21250826-21250848 AGTTTTGGCCTGGAGCATTGGGG + Exonic
1136052778 16:27664903-27664925 ATGTGTGACAGGGAGCCCTGAGG + Intronic
1136902242 16:34051415-34051437 AGGAGTGAACTGGGGCCCTGAGG - Intergenic
1137343888 16:47636850-47636872 AGGGATGACCTGAAGCCTGGGGG + Intronic
1137788430 16:51154966-51154988 AGTTGTGGCCTGCGGCCTTGGGG - Intergenic
1138613998 16:58150031-58150053 AGGAGTGAGCAGGAGCATTGTGG - Intergenic
1139106208 16:63830079-63830101 AGAACTGACCTGAAGCCTTGAGG - Intergenic
1140189658 16:72804638-72804660 AGGTGTGCCCTTGAGGCTTTAGG - Intronic
1140478470 16:75250534-75250556 AGGAGGGAACGGGAGCCTTGTGG + Intronic
1141124164 16:81388426-81388448 AGTTCTGACCTGGAGCCTTGGGG - Exonic
1141685621 16:85568245-85568267 ACCTGTGACATGGAGCTTTGAGG + Intergenic
1141832631 16:86518204-86518226 ACGGGTGTCCAGGAGCCTTGCGG - Intergenic
1142134879 16:88447210-88447232 ACGCCTGACCTGGGGCCTTGAGG - Intergenic
1142353164 16:89588942-89588964 AGGCCTGACCTGGAGCCCAGGGG - Intronic
1143093983 17:4466989-4467011 AGGTGTGGGGTGGAGCCATGTGG + Intronic
1143501805 17:7343603-7343625 AAGTGTCACCTCGAGGCTTGGGG + Intronic
1143596134 17:7915469-7915491 AGGTGGGAGCTGCAGCCTCGCGG - Intergenic
1144314614 17:14048198-14048220 AGTTGAGAGTTGGAGCCTTGGGG - Intergenic
1144517586 17:15929362-15929384 AGGTGAGCCCAGGAGCCATGGGG + Intergenic
1144832352 17:18138804-18138826 AGGTGTGGTCTGTAGCCTGGGGG - Exonic
1147176362 17:38658530-38658552 TGGAGTGACATGGAGCCTGGTGG + Intergenic
1147420457 17:40319783-40319805 GGGGGTGGCTTGGAGCCTTGGGG + Intronic
1147975964 17:44248235-44248257 AGGTGTGACCCTGAGCCCTAGGG - Intergenic
1148182165 17:45614012-45614034 AGGTGTGTGCTGCAGCCTTGAGG - Intergenic
1148266693 17:46231684-46231706 AGGTGTGTGCTGCAGCCTTGAGG + Intergenic
1149200521 17:54180825-54180847 AGGTGTTACCTTCAGCCATGTGG - Intergenic
1150925830 17:69530882-69530904 AGGTTTGATCTGGAGCTTGGTGG + Intronic
1151658490 17:75506778-75506800 AGGTGAGGCCTGCAGCCTTGGGG - Exonic
1152241054 17:79161375-79161397 GGGTGTGTGCTGGAGCCATGCGG - Intronic
1152381117 17:79942696-79942718 GGGTGTGGCCTGGAGCCAGGAGG - Intronic
1152665866 17:81569075-81569097 AAGTGTAAACTGGATCCTTGGGG + Exonic
1154009113 18:10560329-10560351 AGGTCTGTCCCGAAGCCTTGAGG + Intergenic
1154518236 18:15197471-15197493 AGGAGTGAACTGGGGCCCTGAGG + Intergenic
1155103631 18:22639326-22639348 ATGTGAGAACAGGAGCCTTGAGG - Intergenic
1157684324 18:49630505-49630527 CCCTGTGACCAGGAGCCTTGTGG + Intergenic
1158774107 18:60555709-60555731 AGGGGTGGCCTGAAGCCTGGGGG + Intergenic
1159955640 18:74516632-74516654 GTGTTTGGCCTGGAGCCTTGAGG - Intronic
1160510796 18:79452333-79452355 AGGGGTGACCTGTGCCCTTGGGG - Intronic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1162061099 19:8096050-8096072 GAGTGTGACCGGCAGCCTTGTGG - Exonic
1162314950 19:9933131-9933153 AGGTGAGAGAGGGAGCCTTGTGG - Intronic
1163103465 19:15110443-15110465 AGGTGTGGCCTGGAGCAGCGAGG + Intronic
1163417559 19:17195662-17195684 GGCTGGGACCTGGAGCCTTGAGG + Intronic
1163475504 19:17523693-17523715 AGGGGCCACGTGGAGCCTTGTGG - Intronic
1163709841 19:18840027-18840049 GGCTGTGTCCTGGAGCCTTTAGG + Intronic
1163721556 19:18900349-18900371 AGGGTTGGCCTGGAGCCCTGGGG + Intronic
1164912998 19:32027386-32027408 AGGTGTGCCCTTGGGCTTTGGGG + Intergenic
1164943900 19:32274056-32274078 AGGTCTCAGCTGGAGGCTTGGGG - Intergenic
1166776792 19:45317971-45317993 AGGGGTGACCTGGAGGGGTGGGG + Exonic
1166836482 19:45670733-45670755 AGGTGTGACCAGGAGGGCTGGGG + Exonic
1166988715 19:46678000-46678022 GGCTGGGACCTGGAGCCTTTGGG - Intronic
1168213643 19:54909561-54909583 ATGTGCTACCTGGAGCCCTGAGG + Intronic
925001503 2:406605-406627 AGGAGTGGCCTTGTGCCTTGGGG + Intergenic
925655391 2:6142217-6142239 AGGTGTTACCAGGAGGCCTGGGG - Intergenic
928398978 2:30964491-30964513 AGGTGTCACCGGGAGTCTCGGGG - Intronic
933053099 2:77625820-77625842 AGGTGTGCCATGGTACCTTGTGG - Intergenic
934295579 2:91740281-91740303 AGCTCTGGCCTGGAGCCTGGTGG - Intergenic
934550735 2:95260010-95260032 AGGTGAAACCTGGATCCTGGAGG + Intergenic
934724225 2:96604879-96604901 AGGACTGACCAGGGGCCTTGGGG - Intronic
935330550 2:101974473-101974495 CAGAGTGACCTTGAGCCTTGAGG + Intergenic
937031030 2:118740682-118740704 TGGTGTGCCCTGGAGCCCTCTGG - Intergenic
937615785 2:123920824-123920846 AGGTGGGAGGTGGAGCCTAGTGG - Intergenic
939137385 2:138313597-138313619 AGGTGTGAAGTGGAGAATTGAGG - Intergenic
940790173 2:158023619-158023641 AGTTGGGACATGGAGCTTTGGGG + Intronic
942602171 2:177652590-177652612 GGTGGTGACATGGAGCCTTGAGG + Intronic
944591621 2:201223081-201223103 AGGTGTGTCCTGGCTCTTTGGGG + Intronic
946393813 2:219433112-219433134 AGGCCTGACCTTGAGCCCTGAGG - Intergenic
946421358 2:219566957-219566979 AGGTGGAACCTGGGGCCCTGCGG - Exonic
946427661 2:219608127-219608149 AGGAGTCACCTGGAGCCCTCCGG + Exonic
948103132 2:235391239-235391261 AGGTGAGAGCTGGAACCTAGAGG + Intergenic
948723273 2:239916914-239916936 AGATCTGACCAGGAGCCATGGGG + Intronic
948996007 2:241579375-241579397 AGGTGAGAAATGGAGTCTTGGGG - Intergenic
1170428891 20:16259719-16259741 AGGGGTGACCTGGTGCGCTGGGG - Intergenic
1170428937 20:16259897-16259919 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1170428956 20:16259957-16259979 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1170428973 20:16260017-16260039 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1170428992 20:16260077-16260099 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1170429011 20:16260137-16260159 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1170429030 20:16260197-16260219 AGGGGTGACCTGGTGCATTGGGG - Intergenic
1172604974 20:36208016-36208038 TGGTGTGACCTGGTGCCCAGAGG + Intronic
1173925121 20:46775321-46775343 TGGGGTGTCCTGGAGCCCTGAGG + Intergenic
1175152609 20:56946895-56946917 TGCTGTGACCAGGACCCTTGGGG + Intergenic
1177054227 21:16280126-16280148 AGGTGCGACCTAGAGAGTTGTGG + Intergenic
1177932219 21:27298980-27299002 AGTAGTGACCTTGAGACTTGAGG - Intergenic
1179717223 21:43295607-43295629 GGGCGTGACCTGAAGCCTGGGGG + Intergenic
1179937371 21:44613959-44613981 AGGCCTGAGCTGGAGCCGTGTGG - Intronic
1184183163 22:42844967-42844989 AGGAGTGACCTAGAGCCTGAGGG - Intronic
1184503030 22:44885405-44885427 AGGTGTGCCCCGGGGCCTGGGGG - Exonic
1184851828 22:47125340-47125362 AGGCGTGCCCTGGAGACCTGGGG + Intronic
1185316256 22:50180489-50180511 AGCTGTGGCCTGAAGCCCTGGGG + Intergenic
949981017 3:9501683-9501705 TGGTGGCACCTGGAGCTTTGTGG + Exonic
951067422 3:18283378-18283400 AGGTGTGCCATAGAGCGTTGTGG + Intronic
952635821 3:35529398-35529420 AGGTGTGACCAGATGCCTGGAGG - Intergenic
956699719 3:71948281-71948303 TGGTGGGAGCTGGAGCCATGTGG + Intergenic
959137680 3:102444963-102444985 ATGTGTGACATGCAGTCTTGGGG - Intronic
960999743 3:123366258-123366280 AGGAGGGACCTGGAGCATAGTGG + Intronic
962207461 3:133446733-133446755 AGGGGTTTCATGGAGCCTTGAGG - Intronic
963625261 3:147663840-147663862 ATTTGTGATCTGAAGCCTTGGGG - Intergenic
968289386 3:197526834-197526856 ATGTGTGCCCTGGAGTCTGGAGG - Intronic
969277743 4:6148411-6148433 ATGTGTTTCCTGGAGCCCTGAGG - Intronic
973847446 4:54927461-54927483 AAGTGTGACCTGGAGCCTTTAGG - Intergenic
978738612 4:112112674-112112696 ATGTGTTATCTGGAGGCTTGGGG + Intergenic
979487270 4:121283549-121283571 AGGCCTGACCTGGAGCCTTGGGG - Intergenic
979569540 4:122202121-122202143 TGGTTTGACTGGGAGCCTTGGGG + Intronic
980236311 4:130111577-130111599 AGGTCTGGGCAGGAGCCTTGTGG - Intergenic
980241060 4:130176346-130176368 AGGTTAGACCTGGATCCTTAAGG + Intergenic
981324629 4:143431728-143431750 AAGTGTGACCTGTAACCATGTGG - Intronic
981939399 4:150266005-150266027 AGCTGTGGCTTGGATCCTTGTGG - Intronic
982344701 4:154344709-154344731 TGGTGTGTCTTGGAGCCCTGAGG + Intronic
986457748 5:7937220-7937242 AGGTTGGACCTGGGGCCTGGTGG + Intergenic
986911915 5:12567739-12567761 AGGTGAGACCTGCATCCTTGAGG - Intergenic
991039674 5:62162595-62162617 AGGGCTGACCTGAAGCCTCGGGG - Intergenic
992029680 5:72709022-72709044 AGGGATGACCTGCAGCCTTGGGG - Intergenic
992041288 5:72836007-72836029 CAGGGTGACCTGGAGACTTGGGG - Intronic
994860124 5:105181923-105181945 GGGACTGACCTGGAGCCTGGAGG - Intergenic
997376475 5:133401104-133401126 AGGTGGGGCCTGGGGGCTTGGGG + Intronic
999771043 5:154775727-154775749 AGGCTTGATCTGGAGCCTTTTGG + Intronic
1001309917 5:170603294-170603316 AGGTGTGATTTGGACCATTGAGG - Intronic
1002070498 5:176676592-176676614 AAGTGTGACCTGGGCCCTGGCGG - Intergenic
1002631875 5:180587521-180587543 AAGTGTGATCTTGAGCCTTAAGG + Intergenic
1002678033 5:180935223-180935245 AGGGATGACCTGAAGCCTGGGGG - Intronic
1006804024 6:36777041-36777063 AAGTGTGAGCTGGAGCATTCCGG - Intronic
1006874061 6:37280089-37280111 AGCTGGGACCTGGGGCCTTTAGG - Intronic
1011607024 6:89116066-89116088 AGCTGTCAGCTGGAGCCTAGAGG + Intronic
1016322701 6:142864264-142864286 GAGTGTCACCTGGAGCCTGGAGG + Intronic
1016816326 6:148306396-148306418 AGCTGAGGCCTGGAACCTTGGGG - Intronic
1019569701 7:1705135-1705157 GGGTGTGACCTGCAGCCCTCAGG - Intronic
1019685448 7:2379490-2379512 AGGAGTGACCTGGAGCACTGTGG + Exonic
1019868590 7:3737126-3737148 AGGTGTGCTCTGCAGCCTGGTGG + Intronic
1021864683 7:24943276-24943298 TGGTGTGACCTAGAGTATTGGGG - Intronic
1022130414 7:27399840-27399862 GGCTGTGACTTGGAGCCATGTGG - Intergenic
1023959408 7:44914015-44914037 TGGTTTGGCCTGGAGCCCTGAGG + Intergenic
1024539793 7:50466926-50466948 AGGTGTGGGATGGAGCCTTGAGG + Intronic
1025092854 7:56077860-56077882 GGGCTTGACCTGGAGCCCTGTGG + Intronic
1028661292 7:93279167-93279189 AGCACTGACCAGGAGCCTTGGGG - Intronic
1029363121 7:100101181-100101203 TGGTGTGAGCTGGGGTCTTGGGG - Intronic
1030114942 7:106055828-106055850 AGGCGTGAGCTGCAGCCATGGGG - Intergenic
1030470615 7:109958453-109958475 ATGAGTGACCTGGAGCATGGGGG + Intergenic
1032164026 7:129531782-129531804 AGGTGTGGCCTTGAGACTGGGGG - Intergenic
1032386682 7:131530160-131530182 AGGTGTGCCCTGGAGAGCTGGGG - Intronic
1032821487 7:135528136-135528158 AGGTGTGAACTTGTGCCTGGTGG + Intergenic
1033026678 7:137781229-137781251 AGGTGTGGCCAGGAGCCTAAGGG + Intronic
1033034577 7:137861906-137861928 AGGTGGGAACTGGAGACTTGAGG + Intergenic
1034299036 7:149999028-149999050 AGCTGTCACCTGGGGGCTTGTGG - Intergenic
1035569286 8:661311-661333 AGTTCTGCCCTGGAGCCTGGCGG + Intronic
1035618147 8:1017656-1017678 GTGTGTGACCAGGAGCCTTTTGG + Intergenic
1036419801 8:8585058-8585080 AGTTGCAACCTGGAGCCCTGTGG - Intergenic
1036807819 8:11847408-11847430 TGGCGTGTCCTGGAGTCTTGAGG - Intronic
1039531540 8:38267716-38267738 AGGTGTCACCTGGAGGACTGAGG + Intronic
1040287245 8:46106725-46106747 AGGTGAGCCCTGGAGGCTTCTGG + Intergenic
1041140387 8:54811915-54811937 AGCTCTGACTTGGAGTCTTGTGG + Intergenic
1045405331 8:101860718-101860740 AGGTGTGCACTGGAGAATTGAGG + Intronic
1047006264 8:120623465-120623487 AGGTGTGCCCTGGTTCCTAGGGG - Intronic
1048374127 8:133807431-133807453 TGGTGTTACCAGGAGCCTTAGGG + Intergenic
1050666739 9:7946501-7946523 ATGCGTGACTTAGAGCCTTGGGG - Intergenic
1050808893 9:9718977-9718999 AGGGATGACCTGAAGCCTGGGGG + Intronic
1057183283 9:93041078-93041100 GGCTGTGCCCTGGAGGCTTGGGG + Intergenic
1058607114 9:106734663-106734685 AGGTGTGAGCTGGAGAACTGTGG + Intergenic
1058918500 9:109590689-109590711 AGATGTGCCCTGGAGGCTAGTGG - Intergenic
1058983052 9:110187934-110187956 AGCTATGACCTGGAGCCCTTTGG - Intergenic
1061701913 9:132422589-132422611 AGGAGGAACCTGGAGCTTTGGGG + Intronic
1061850567 9:133412535-133412557 GGCTCTGACCTGGAGCCCTGTGG - Intronic
1191721719 X:64235667-64235689 AGGTGTGAGGTGGAATCTTGTGG + Intergenic
1200787982 Y:7275437-7275459 AGGTGTGACCTTAAGCCCTTGGG - Intergenic