ID: 1080639277

View in Genome Browser
Species Human (GRCh38)
Location 11:34149373-34149395
Sequence CTCGGCTCCAGTGGGTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639277_1080639283 17 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639283 11:34149413-34149435 CAACCCATGCTCACAGCACCTGG No data
1080639277_1080639287 27 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639277_1080639288 28 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639277_1080639284 18 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639277 Original CRISPR CTCGGCTCCAGTGGGTCCAC AGG (reversed) Intergenic
No off target data available for this crispr