ID: 1080639278

View in Genome Browser
Species Human (GRCh38)
Location 11:34149381-34149403
Sequence GGATTTCACTCGGCTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639278_1080639287 19 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639278_1080639283 9 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639283 11:34149413-34149435 CAACCCATGCTCACAGCACCTGG No data
1080639278_1080639284 10 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639278_1080639288 20 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639278 Original CRISPR GGATTTCACTCGGCTCCAGT GGG (reversed) Intergenic
No off target data available for this crispr