ID: 1080639279

View in Genome Browser
Species Human (GRCh38)
Location 11:34149382-34149404
Sequence GGGATTTCACTCGGCTCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639279_1080639284 9 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639279_1080639283 8 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639283 11:34149413-34149435 CAACCCATGCTCACAGCACCTGG No data
1080639279_1080639287 18 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639279_1080639288 19 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639279 Original CRISPR GGGATTTCACTCGGCTCCAG TGG (reversed) Intergenic