ID: 1080639280

View in Genome Browser
Species Human (GRCh38)
Location 11:34149391-34149413
Sequence GCATCTACAGGGATTTCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639280_1080639287 9 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639280_1080639283 -1 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639283 11:34149413-34149435 CAACCCATGCTCACAGCACCTGG No data
1080639280_1080639290 23 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639290 11:34149437-34149459 TCCTCAAGGGCTCCAGTAAGAGG No data
1080639280_1080639284 0 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639280_1080639292 24 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639280_1080639288 10 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639280 Original CRISPR GCATCTACAGGGATTTCACT CGG (reversed) Intergenic