ID: 1080639281

View in Genome Browser
Species Human (GRCh38)
Location 11:34149402-34149424
Sequence GAGCATGGGTTGCATCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639281_1080639287 -2 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639281_1080639292 13 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639281_1080639290 12 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639290 11:34149437-34149459 TCCTCAAGGGCTCCAGTAAGAGG No data
1080639281_1080639288 -1 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639281 Original CRISPR GAGCATGGGTTGCATCTACA GGG (reversed) Intergenic
No off target data available for this crispr