ID: 1080639282

View in Genome Browser
Species Human (GRCh38)
Location 11:34149403-34149425
Sequence TGAGCATGGGTTGCATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639282_1080639287 -3 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639282_1080639292 12 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639282_1080639290 11 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639290 11:34149437-34149459 TCCTCAAGGGCTCCAGTAAGAGG No data
1080639282_1080639288 -2 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639282 Original CRISPR TGAGCATGGGTTGCATCTAC AGG (reversed) Intergenic
No off target data available for this crispr