ID: 1080639284

View in Genome Browser
Species Human (GRCh38)
Location 11:34149414-34149436
Sequence AACCCATGCTCACAGCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639280_1080639284 0 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639279_1080639284 9 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639277_1080639284 18 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data
1080639278_1080639284 10 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639284 11:34149414-34149436 AACCCATGCTCACAGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639284 Original CRISPR AACCCATGCTCACAGCACCT GGG Intergenic