ID: 1080639285 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:34149416-34149438 |
| Sequence | GACCCAGGTGCTGTGAGCAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1080639285_1080639292 | -1 | Left | 1080639285 | 11:34149416-34149438 | CCCATGCTCACAGCACCTGGGTC | No data | ||
| Right | 1080639292 | 11:34149438-34149460 | CCTCAAGGGCTCCAGTAAGAGGG | No data | ||||
| 1080639285_1080639290 | -2 | Left | 1080639285 | 11:34149416-34149438 | CCCATGCTCACAGCACCTGGGTC | No data | ||
| Right | 1080639290 | 11:34149437-34149459 | TCCTCAAGGGCTCCAGTAAGAGG | No data | ||||
| 1080639285_1080639294 | 23 | Left | 1080639285 | 11:34149416-34149438 | CCCATGCTCACAGCACCTGGGTC | No data | ||
| Right | 1080639294 | 11:34149462-34149484 | AACTCCCCCAAGCCTGCCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1080639285 | Original CRISPR | GACCCAGGTGCTGTGAGCAT GGG (reversed) | Intergenic | ||