ID: 1080639285

View in Genome Browser
Species Human (GRCh38)
Location 11:34149416-34149438
Sequence GACCCAGGTGCTGTGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639285_1080639292 -1 Left 1080639285 11:34149416-34149438 CCCATGCTCACAGCACCTGGGTC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639285_1080639290 -2 Left 1080639285 11:34149416-34149438 CCCATGCTCACAGCACCTGGGTC No data
Right 1080639290 11:34149437-34149459 TCCTCAAGGGCTCCAGTAAGAGG No data
1080639285_1080639294 23 Left 1080639285 11:34149416-34149438 CCCATGCTCACAGCACCTGGGTC No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639285 Original CRISPR GACCCAGGTGCTGTGAGCAT GGG (reversed) Intergenic
No off target data available for this crispr