ID: 1080639286 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:34149417-34149439 |
Sequence | GGACCCAGGTGCTGTGAGCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1080639286_1080639290 | -3 | Left | 1080639286 | 11:34149417-34149439 | CCATGCTCACAGCACCTGGGTCC | No data | ||
Right | 1080639290 | 11:34149437-34149459 | TCCTCAAGGGCTCCAGTAAGAGG | No data | ||||
1080639286_1080639294 | 22 | Left | 1080639286 | 11:34149417-34149439 | CCATGCTCACAGCACCTGGGTCC | No data | ||
Right | 1080639294 | 11:34149462-34149484 | AACTCCCCCAAGCCTGCCTGTGG | No data | ||||
1080639286_1080639292 | -2 | Left | 1080639286 | 11:34149417-34149439 | CCATGCTCACAGCACCTGGGTCC | No data | ||
Right | 1080639292 | 11:34149438-34149460 | CCTCAAGGGCTCCAGTAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1080639286 | Original CRISPR | GGACCCAGGTGCTGTGAGCA TGG (reversed) | Intergenic | ||