ID: 1080639287

View in Genome Browser
Species Human (GRCh38)
Location 11:34149423-34149445
Sequence TCACAGCACCTGGGTCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639279_1080639287 18 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639280_1080639287 9 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639281_1080639287 -2 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639278_1080639287 19 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639282_1080639287 -3 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data
1080639277_1080639287 27 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639287 11:34149423-34149445 TCACAGCACCTGGGTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639287 Original CRISPR TCACAGCACCTGGGTCCTCA AGG Intergenic
No off target data available for this crispr