ID: 1080639288

View in Genome Browser
Species Human (GRCh38)
Location 11:34149424-34149446
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639277_1080639288 28 Left 1080639277 11:34149373-34149395 CCTGTGGACCCACTGGAGCCGAG No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639282_1080639288 -2 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639281_1080639288 -1 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639279_1080639288 19 Left 1080639279 11:34149382-34149404 CCACTGGAGCCGAGTGAAATCCC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639280_1080639288 10 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data
1080639278_1080639288 20 Left 1080639278 11:34149381-34149403 CCCACTGGAGCCGAGTGAAATCC No data
Right 1080639288 11:34149424-34149446 CACAGCACCTGGGTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639288 Original CRISPR CACAGCACCTGGGTCCTCAA GGG Intergenic