ID: 1080639289

View in Genome Browser
Species Human (GRCh38)
Location 11:34149431-34149453
Sequence ACTGGAGCCCTTGAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639289_1080639300 22 Left 1080639289 11:34149431-34149453 CCTGGGTCCTCAAGGGCTCCAGT No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data
1080639289_1080639294 8 Left 1080639289 11:34149431-34149453 CCTGGGTCCTCAAGGGCTCCAGT No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639289_1080639302 25 Left 1080639289 11:34149431-34149453 CCTGGGTCCTCAAGGGCTCCAGT No data
Right 1080639302 11:34149479-34149501 CTGTGGCTGCTCATAGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639289 Original CRISPR ACTGGAGCCCTTGAGGACCC AGG (reversed) Intergenic