ID: 1080639291

View in Genome Browser
Species Human (GRCh38)
Location 11:34149438-34149460
Sequence CCCTCTTACTGGAGCCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639291_1080639303 24 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639303 11:34149485-34149507 CTGCTCATAGCAGGCGGAGCAGG No data
1080639291_1080639305 29 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639291_1080639302 18 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639302 11:34149479-34149501 CTGTGGCTGCTCATAGCAGGCGG No data
1080639291_1080639294 1 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639291_1080639300 15 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data
1080639291_1080639304 25 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639304 11:34149486-34149508 TGCTCATAGCAGGCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639291 Original CRISPR CCCTCTTACTGGAGCCCTTG AGG (reversed) Intergenic