ID: 1080639292

View in Genome Browser
Species Human (GRCh38)
Location 11:34149438-34149460
Sequence CCTCAAGGGCTCCAGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639285_1080639292 -1 Left 1080639285 11:34149416-34149438 CCCATGCTCACAGCACCTGGGTC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639286_1080639292 -2 Left 1080639286 11:34149417-34149439 CCATGCTCACAGCACCTGGGTCC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639280_1080639292 24 Left 1080639280 11:34149391-34149413 CCGAGTGAAATCCCTGTAGATGC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639281_1080639292 13 Left 1080639281 11:34149402-34149424 CCCTGTAGATGCAACCCATGCTC No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
1080639282_1080639292 12 Left 1080639282 11:34149403-34149425 CCTGTAGATGCAACCCATGCTCA No data
Right 1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639292 Original CRISPR CCTCAAGGGCTCCAGTAAGA GGG Intergenic
No off target data available for this crispr