ID: 1080639293

View in Genome Browser
Species Human (GRCh38)
Location 11:34149449-34149471
Sequence TGGGGGAGTTACCCTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639293_1080639294 -10 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639293_1080639300 4 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data
1080639293_1080639305 18 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639293_1080639302 7 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639302 11:34149479-34149501 CTGTGGCTGCTCATAGCAGGCGG No data
1080639293_1080639303 13 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639303 11:34149485-34149507 CTGCTCATAGCAGGCGGAGCAGG No data
1080639293_1080639304 14 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639304 11:34149486-34149508 TGCTCATAGCAGGCGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639293 Original CRISPR TGGGGGAGTTACCCTCTTAC TGG (reversed) Intergenic