ID: 1080639294

View in Genome Browser
Species Human (GRCh38)
Location 11:34149462-34149484
Sequence AACTCCCCCAAGCCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639286_1080639294 22 Left 1080639286 11:34149417-34149439 CCATGCTCACAGCACCTGGGTCC No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639291_1080639294 1 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639293_1080639294 -10 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639285_1080639294 23 Left 1080639285 11:34149416-34149438 CCCATGCTCACAGCACCTGGGTC No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data
1080639289_1080639294 8 Left 1080639289 11:34149431-34149453 CCTGGGTCCTCAAGGGCTCCAGT No data
Right 1080639294 11:34149462-34149484 AACTCCCCCAAGCCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639294 Original CRISPR AACTCCCCCAAGCCTGCCTG TGG Intergenic