ID: 1080639296

View in Genome Browser
Species Human (GRCh38)
Location 11:34149467-34149489
Sequence AGCAGCCACAGGCAGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639296_1080639303 -5 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639303 11:34149485-34149507 CTGCTCATAGCAGGCGGAGCAGG No data
1080639296_1080639310 28 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639310 11:34149518-34149540 AGCAGTGGCCCGGAATTAGGAGG No data
1080639296_1080639305 0 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639296_1080639309 25 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639309 11:34149515-34149537 GTGAGCAGTGGCCCGGAATTAGG No data
1080639296_1080639306 13 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639306 11:34149503-34149525 GCAGGGCAGGCCGTGAGCAGTGG No data
1080639296_1080639304 -4 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639304 11:34149486-34149508 TGCTCATAGCAGGCGGAGCAGGG No data
1080639296_1080639307 18 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639307 11:34149508-34149530 GCAGGCCGTGAGCAGTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639296 Original CRISPR AGCAGCCACAGGCAGGCTTG GGG (reversed) Intergenic