ID: 1080639298

View in Genome Browser
Species Human (GRCh38)
Location 11:34149469-34149491
Sequence TGAGCAGCCACAGGCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639298_1080639309 23 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639309 11:34149515-34149537 GTGAGCAGTGGCCCGGAATTAGG No data
1080639298_1080639305 -2 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639298_1080639307 16 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639307 11:34149508-34149530 GCAGGCCGTGAGCAGTGGCCCGG No data
1080639298_1080639303 -7 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639303 11:34149485-34149507 CTGCTCATAGCAGGCGGAGCAGG No data
1080639298_1080639310 26 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639310 11:34149518-34149540 AGCAGTGGCCCGGAATTAGGAGG No data
1080639298_1080639304 -6 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639304 11:34149486-34149508 TGCTCATAGCAGGCGGAGCAGGG No data
1080639298_1080639306 11 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639306 11:34149503-34149525 GCAGGGCAGGCCGTGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639298 Original CRISPR TGAGCAGCCACAGGCAGGCT TGG (reversed) Intergenic