ID: 1080639299

View in Genome Browser
Species Human (GRCh38)
Location 11:34149474-34149496
Sequence TGCTATGAGCAGCCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639299_1080639309 18 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639309 11:34149515-34149537 GTGAGCAGTGGCCCGGAATTAGG No data
1080639299_1080639305 -7 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639299_1080639307 11 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639307 11:34149508-34149530 GCAGGCCGTGAGCAGTGGCCCGG No data
1080639299_1080639306 6 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639306 11:34149503-34149525 GCAGGGCAGGCCGTGAGCAGTGG No data
1080639299_1080639310 21 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639310 11:34149518-34149540 AGCAGTGGCCCGGAATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639299 Original CRISPR TGCTATGAGCAGCCACAGGC AGG (reversed) Intergenic