ID: 1080639300

View in Genome Browser
Species Human (GRCh38)
Location 11:34149476-34149498
Sequence TGCCTGTGGCTGCTCATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639291_1080639300 15 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data
1080639293_1080639300 4 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data
1080639289_1080639300 22 Left 1080639289 11:34149431-34149453 CCTGGGTCCTCAAGGGCTCCAGT No data
Right 1080639300 11:34149476-34149498 TGCCTGTGGCTGCTCATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639300 Original CRISPR TGCCTGTGGCTGCTCATAGC AGG Intergenic