ID: 1080639305

View in Genome Browser
Species Human (GRCh38)
Location 11:34149490-34149512
Sequence CATAGCAGGCGGAGCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080639291_1080639305 29 Left 1080639291 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639298_1080639305 -2 Left 1080639298 11:34149469-34149491 CCAAGCCTGCCTGTGGCTGCTCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639296_1080639305 0 Left 1080639296 11:34149467-34149489 CCCCAAGCCTGCCTGTGGCTGCT No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639295_1080639305 1 Left 1080639295 11:34149466-34149488 CCCCCAAGCCTGCCTGTGGCTGC No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639299_1080639305 -7 Left 1080639299 11:34149474-34149496 CCTGCCTGTGGCTGCTCATAGCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639293_1080639305 18 Left 1080639293 11:34149449-34149471 CCAGTAAGAGGGTAACTCCCCCA No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data
1080639297_1080639305 -1 Left 1080639297 11:34149468-34149490 CCCAAGCCTGCCTGTGGCTGCTC No data
Right 1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080639305 Original CRISPR CATAGCAGGCGGAGCAGGGC AGG Intergenic