ID: 1080640663

View in Genome Browser
Species Human (GRCh38)
Location 11:34156459-34156481
Sequence CTGATACTGCAGAAACCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080640656_1080640663 29 Left 1080640656 11:34156407-34156429 CCTGTAGAAGGGCAGCAGGGTTT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 216
1080640661_1080640663 -2 Left 1080640661 11:34156438-34156460 CCTGAGTGGGCCACTTGGAAGCT 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 216
1080640659_1080640663 6 Left 1080640659 11:34156430-34156452 CCTTCTGTCCTGAGTGGGCCACT 0: 1
1: 0
2: 2
3: 20
4: 194
Right 1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080640663 Original CRISPR CTGATACTGCAGAAACCATG TGG Intronic
904844160 1:33396255-33396277 CTGATCCTGCATTAACCCTGTGG - Intronic
906155425 1:43611429-43611451 CTCATGCTGCAGAAACCCTCAGG - Intronic
909027329 1:70497508-70497530 CTGCTCCTGTAGTAACCATGTGG + Intergenic
909593599 1:77379551-77379573 CTGATACTGCAGGAAACGTAAGG + Intronic
910716061 1:90232164-90232186 CTGATACTGCAGAAACTCAAAGG - Intergenic
911233828 1:95388172-95388194 CTGCTACAGCAGAACCCATATGG + Intergenic
917994971 1:180427562-180427584 CTGATACGTAAGAAACCATACGG + Intronic
918077341 1:181180689-181180711 CTGACAGGGCAGAAACAATGGGG - Intergenic
919012999 1:191989514-191989536 CTGATACTGCAGAAATCCAAGGG + Intergenic
919990809 1:202707897-202707919 ATGATACTGCAGAGACCTGGGGG - Intronic
920076530 1:203341355-203341377 CTCATACTTTAAAAACCATGTGG + Exonic
920764458 1:208818372-208818394 CTGGTGTTGGAGAAACCATGAGG - Intergenic
923039217 1:230307930-230307952 CAGATAATGCAGAAGCCCTGAGG + Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924084626 1:240438122-240438144 CAGATACTGAAGAAAGCATTTGG - Exonic
924813156 1:247420940-247420962 CAGATACTGGACAAAACATGTGG - Intronic
1063356322 10:5402427-5402449 CTGATGATGCAGAAGACATGGGG - Intronic
1065849246 10:29773105-29773127 CTGGTACTGCACAAACCAATAGG - Intergenic
1066986610 10:42474296-42474318 CTAACAGTGAAGAAACCATGAGG + Intergenic
1069658722 10:70109353-70109375 TTCATCCTTCAGAAACCATGGGG + Intronic
1071316649 10:84407598-84407620 TTGCTATTGCAGAATCCATGTGG - Intronic
1071963363 10:90828529-90828551 CTGATACTGCAGAAACTCAAAGG + Intronic
1072191261 10:93078416-93078438 GCAATACTGCAGAAACCAGGTGG + Intergenic
1072307415 10:94120914-94120936 TTAATAATGAAGAAACCATGGGG + Intronic
1075878213 10:125825209-125825231 CTGTTCCTGCTGAAGCCATGTGG + Intronic
1076310571 10:129503980-129504002 CTGATACTGTTGAAACCATCAGG - Intronic
1076468370 10:130701420-130701442 CTGGCACTGCAGAAAACATCAGG - Intergenic
1076630275 10:131848257-131848279 CTGATGCTGCAGCCGCCATGAGG + Intergenic
1078418190 11:11183041-11183063 CTTGTACTGTAGAAACCATTTGG - Intergenic
1079637294 11:22759677-22759699 CTGTTACTGCAGAAATCAGAAGG - Intronic
1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG + Intronic
1084829130 11:71754943-71754965 ATGAGACTTCAGATACCATGAGG - Intergenic
1089161077 11:116437819-116437841 CTGATTCTGCAGAAACACTGTGG - Intergenic
1089623078 11:119733872-119733894 CTGATGCTGCAGAAAGCAGGTGG + Intergenic
1089871228 11:121674102-121674124 GTTATACTGCAAAAACCAAGAGG - Intergenic
1089989723 11:122847961-122847983 CTGCTGCTGCAGAAACCACATGG - Intronic
1090481967 11:127077021-127077043 GTGATACTGCAAAAATGATGGGG + Intergenic
1090515406 11:127420334-127420356 CTGATACTGCAGAAATCCAAAGG - Intergenic
1091808688 12:3376998-3377020 CTGTGACTGAAGAAAGCATGTGG - Intergenic
1092276622 12:7066322-7066344 CTGAGACTGCAGACAGCTTGCGG + Intronic
1093593539 12:20935616-20935638 CTGATACTGCAGAAAGCCAAAGG - Intergenic
1093949500 12:25148648-25148670 GTGATACTTCAGAAACAAAGGGG - Intronic
1094189223 12:27680111-27680133 CTAATACTGCAGGACTCATGAGG - Intronic
1094583450 12:31755630-31755652 TTGAAATTGCAGAAACAATGCGG + Intergenic
1097377991 12:58860990-58861012 CTGATGCTGCAGACAGCAGGGGG + Intergenic
1098189148 12:67929479-67929501 CAGATACACCAGAAACCATGCGG - Intergenic
1098378939 12:69847248-69847270 CAGAAACTGCAGAAAGGATGGGG + Intronic
1101250489 12:102929454-102929476 GTCATATTGCAGAAACAATGGGG + Intronic
1101316689 12:103635445-103635467 CCGGCACTGGAGAAACCATGTGG - Intronic
1102912791 12:116731282-116731304 CTGATGGTGCAGAAGTCATGGGG - Intronic
1103473634 12:121201952-121201974 CTGATACTGCTGAAAACAAGAGG - Intergenic
1103614328 12:122142542-122142564 CTGACATTGCAGGATCCATGGGG + Exonic
1103646241 12:122395389-122395411 CCGATTCTACAGACACCATGAGG - Intronic
1104197863 12:126558401-126558423 CTGATTCTGCACAAGCCATCAGG - Intergenic
1107643302 13:42467427-42467449 CTGATACTGCAGAAACTCAAAGG + Intergenic
1107756489 13:43629047-43629069 CTGATACTGCAGCATGAATGAGG + Intronic
1110093936 13:71491453-71491475 CTCATACAGCTGAAACCACGAGG - Intronic
1112987327 13:105467298-105467320 CTAACACTCCAGAAACCAAGAGG - Intronic
1113671652 13:112179617-112179639 CTGATACTGCAGAAGGAAGGGGG + Intergenic
1114178159 14:20342681-20342703 GTGAAACTGCAGAAACCCTTTGG - Intergenic
1115821467 14:37217081-37217103 CTGATACTGCAGAAATTCTAAGG + Intronic
1117259490 14:54016550-54016572 CTGAGACATCAAAAACCATGTGG + Intergenic
1117920902 14:60724200-60724222 CAGATACAGCCGAAACCAGGAGG - Intronic
1118127787 14:62928201-62928223 ATGATCCTGCAGAAGTCATGCGG + Intronic
1118378098 14:65194163-65194185 CTGAGAATGCAGAATCCTTGGGG - Intergenic
1118966467 14:70591033-70591055 CTGAAACTTCACAAACTATGAGG - Intronic
1119244666 14:73093805-73093827 CTTATACTTCAGAAACCAGATGG - Intronic
1125966341 15:43878593-43878615 CTGATAAAGCAGAAACCTTAAGG + Intronic
1127035469 15:54911968-54911990 CTGATACTGCAGAAACTCAAAGG + Intergenic
1129182794 15:73887561-73887583 CTGAGACTGCAGATGCCCTGAGG - Intronic
1129828466 15:78651314-78651336 CTGTCACTGCTGAAACCAAGGGG - Intronic
1130766011 15:86871966-86871988 CTGATACTACAAAAACCCTGTGG + Intronic
1131888003 15:96940157-96940179 CTGATACTGCAGAAATCCAAAGG - Intergenic
1133574425 16:7074705-7074727 CTTATACTCCAGAGAGCATGGGG + Intronic
1133689881 16:8203237-8203259 CTGTTCCTGCAGAAGCCATTAGG - Intergenic
1134231246 16:12432301-12432323 CTGGTTCTCCAGAAACCTTGTGG + Intronic
1139275842 16:65726891-65726913 TTGATACAGCAGAAACCTTGGGG + Intergenic
1139316189 16:66071107-66071129 GTGATGCTGCAGAAAGCATATGG - Intergenic
1145187607 17:20808740-20808762 CAGAAACTGCAGAAAGCATAAGG - Intergenic
1146659194 17:34653254-34653276 CAGAGGCTGCAGAGACCATGGGG + Intergenic
1146851374 17:36224674-36224696 CTGAAACTGCAGAGAGCATACGG + Intronic
1146867284 17:36348547-36348569 CTGAAACTGCAGAGAGCATACGG + Intronic
1147070161 17:37949158-37949180 CTGAAACTGCAGAGAGCATACGG + Intergenic
1147081682 17:38028684-38028706 CTGAAACTGCAGAGAGCATACGG + Intronic
1147097633 17:38152654-38152676 CTGAAACTGCAGAGAGCATACGG + Intergenic
1149066485 17:52486642-52486664 CTGATAGTGGAGAAATCATGTGG + Intergenic
1149108858 17:53001667-53001689 CTGATACTGCAGAAAACCAAAGG + Intergenic
1149294326 17:55248073-55248095 CTGATACTGTGGAAACCCTCGGG + Intergenic
1150079333 17:62222774-62222796 CTGAAACTGCAGAAAGCATACGG + Intergenic
1152937648 17:83149852-83149874 CTCATGCTGGAGATACCATGAGG - Intergenic
1155017078 18:21854285-21854307 TGGTTACTACAGAAACCATGTGG - Intronic
1158644067 18:59228729-59228751 TTCATGTTGCAGAAACCATGGGG - Intronic
1158926569 18:62270139-62270161 CTGCTGCTTCAGAAGCCATGTGG - Intronic
1160604451 18:80038907-80038929 CTGAGGGTACAGAAACCATGAGG + Intronic
1165744178 19:38220962-38220984 CTGATACGCCAGACACCATCAGG + Intronic
930935380 2:56943297-56943319 CTGATACTGCAGAAATTCAGAGG - Intergenic
931660100 2:64552496-64552518 CTGATAATTCAGAAGCCATTAGG + Exonic
934779924 2:96963446-96963468 CTGATGTTGCAGGAAGCATGTGG - Intronic
935284153 2:101549042-101549064 CTGATACTCCGTGAACCATGAGG + Intergenic
937496745 2:122428591-122428613 CTCATCCTCCAGAAACCAAGAGG - Intergenic
937651535 2:124324655-124324677 CTGACAATGCTGAAACAATGTGG + Intronic
938256636 2:129864360-129864382 CTGCCACGGCAGAACCCATGTGG - Intergenic
940079841 2:149788341-149788363 CTGAGACTTAAGAAACAATGGGG - Intergenic
941227986 2:162872623-162872645 CTGATACTGCAGAAATTCTAAGG + Intergenic
942615942 2:177792457-177792479 TTGATTATGCAAAAACCATGGGG - Intronic
948398679 2:237666656-237666678 CTGGTACTGCAGAAGCCACACGG + Intronic
1169149380 20:3277267-3277289 CTAATGCTGCAGAGACCTTGAGG - Intronic
1170430453 20:16271137-16271159 CTGATTCTGAATAAAACATGAGG - Intergenic
1170686251 20:18572029-18572051 CTAATACTGTAGAAACCAATTGG - Intronic
1173970652 20:47149760-47149782 CTGAGGCAGCAGAAACCAGGAGG + Intronic
1175519632 20:59591756-59591778 GTGTCACCGCAGAAACCATGTGG + Intronic
1178156334 21:29858359-29858381 CTGGTACTGCAGAAGAGATGAGG - Intronic
1178606984 21:34046853-34046875 GGAATACTGCAGAAAACATGAGG - Intergenic
1179046705 21:37851076-37851098 CTAATACTGTATAACCCATGTGG + Intronic
1179547128 21:42120308-42120330 CTGATATTTCAGAATCCAAGTGG - Intronic
1182164287 22:28157126-28157148 CTGATACTGCAGAAATCCAAAGG + Intronic
949440962 3:4079848-4079870 CTGAAGCTGCAGAAACTGTGGGG + Intronic
950709789 3:14805942-14805964 CTGAGACTGCAGGGACCAAGAGG + Intergenic
951019414 3:17766331-17766353 GTGATACTGAAGAAATCAGGTGG + Intronic
951457516 3:22909200-22909222 CTGGTACTGCAGAATCTATCTGG + Intergenic
952427982 3:33194676-33194698 CTGATAAGGCAGAAACCAGAAGG + Intronic
953610023 3:44439751-44439773 ATGACACTGCAGACACCAAGAGG + Exonic
953669304 3:44949202-44949224 CTGGTATTGTAGATACCATGTGG - Intronic
954900507 3:54015123-54015145 CAGATCCTGGAGAGACCATGTGG + Intergenic
954951476 3:54478255-54478277 CTGAAACTGCAGATACAAAGAGG - Intronic
955629212 3:60953982-60954004 CTCATTCTGCAGAAACCCTTTGG - Intronic
958100867 3:89008019-89008041 CTGATACTGCAGAAATTCAGGGG - Intergenic
958141472 3:89568295-89568317 CTGATACTGCAGAAATTAAAAGG + Intergenic
958630909 3:96682219-96682241 CTGATACTGCAGAAATTAAAAGG - Intergenic
958833630 3:99118363-99118385 CTGAAACTGCAGAACCAGTGTGG - Intergenic
960338130 3:116443633-116443655 CTGATAGTGCATAAACCCTGGGG - Intronic
960804520 3:121570697-121570719 CTCAGATTTCAGAAACCATGAGG + Exonic
963367324 3:144352901-144352923 CACATTCTTCAGAAACCATGAGG - Intergenic
965366839 3:167811353-167811375 CCTATACTGGAGAAAGCATGTGG + Intronic
967696645 3:192539964-192539986 CTGATACTGCAGAAATCCAAAGG - Intronic
972427927 4:38952420-38952442 CTGATATTGCCCAAACCATTCGG + Intergenic
973020456 4:45199249-45199271 CTAACGCTTCAGAAACCATGAGG - Intergenic
974992072 4:69105135-69105157 CTGATAGTGCAGAGTCCTTGTGG - Intronic
975502028 4:75097315-75097337 CTGATACTGCAGAAATTAAAAGG - Intergenic
976436168 4:85021016-85021038 CTAATATCGCAGAAATCATGAGG - Intergenic
977044751 4:92055135-92055157 CTGATACTGCAGAAATGCTAAGG + Intergenic
977236610 4:94514851-94514873 CTGATACTGCAGAAATCCAAAGG - Intronic
977956414 4:103032644-103032666 CTGATACTGGAGAAGCCACCTGG - Intronic
978404045 4:108361286-108361308 CTGCATCTGCAGACACCATGTGG + Intergenic
979296470 4:119038131-119038153 ATGAGACTGTGGAAACCATGTGG - Intronic
980702354 4:136448793-136448815 CTGATATTACAGAAAGAATGGGG + Intergenic
980724849 4:136744871-136744893 CTAATACTTCAGAAAGCATGAGG + Intergenic
982998587 4:162382675-162382697 CTGTTACTACAGAAACTGTGGGG + Intergenic
983595008 4:169456536-169456558 CTGATACTGCAGAAATTAAAAGG + Intronic
988849637 5:35166662-35166684 CTGATACTCCACAAAAAATGAGG + Intronic
990450748 5:55929775-55929797 CTGAGGCTCCAGAAACCAGGTGG - Intergenic
990818408 5:59810658-59810680 CTGAGACTGCAGTGACCCTGAGG - Intronic
991470930 5:66968299-66968321 CTGAGACTCCAGAAACCAAAGGG - Intronic
991663963 5:68978420-68978442 CTGATACTGCAGAAATTCAGAGG + Intergenic
992245788 5:74820946-74820968 CTGAAAATGCAGAAGCCCTGAGG - Intronic
992414745 5:76541475-76541497 CTGATGCTGCAGTTAACATGGGG + Intronic
992570270 5:78048184-78048206 CTGATACTTCAGAAACCCACAGG - Intronic
997943839 5:138182072-138182094 CTGATGCTGCACACACAATGGGG - Intronic
1001936323 5:175708372-175708394 TTCATCCTGCAGAACCCATGAGG - Intergenic
1007005142 6:38354831-38354853 ATAATACTGCAGAAAACTTGAGG + Intronic
1008492147 6:52097521-52097543 CTGATGCTGCAGAGAATATGAGG - Intergenic
1009651446 6:66481454-66481476 CTGATTCCGGAGTAACCATGTGG - Intergenic
1010458550 6:76086661-76086683 CTGCATCTGCAGAAACCAGGAGG - Intergenic
1010639475 6:78306044-78306066 CTGATACTGCAGAAATTAAAAGG - Intergenic
1011033502 6:82948204-82948226 CTGATACTGCAGAAACTCATAGG + Intronic
1011880490 6:92017928-92017950 CTGATATTGCAGAAACGATGTGG + Intergenic
1012070248 6:94604874-94604896 CTGACACTGCACATAGCATGGGG + Intergenic
1012643349 6:101650314-101650336 CTGGTGCTTCAGAAACCAAGTGG - Intronic
1012940853 6:105413698-105413720 CTGATACTGCAGAAATTCAGAGG + Intergenic
1015578357 6:134697256-134697278 CTGATACTGCAGAAACTCAAAGG - Intergenic
1016567857 6:145477117-145477139 CTGATACTGCAGAAACTCAAAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022068982 7:26891793-26891815 CCAATCCTGCAGAAACCATTAGG - Intronic
1022144735 7:27525736-27525758 CTGGTAGTGCAGTAACCATTTGG + Exonic
1022177063 7:27881405-27881427 CTGGTATTACAGAAACCAAGTGG + Intronic
1023862577 7:44225169-44225191 CAGATACTGCACAGACCTTGAGG + Intronic
1026150786 7:67786469-67786491 GTGGGACTCCAGAAACCATGAGG - Intergenic
1028878273 7:95848670-95848692 ATGATACTGCAGTGAACATGGGG + Intronic
1031638816 7:124136722-124136744 CTGATACTGCAGAAATTCAGAGG - Intergenic
1033556281 7:142490863-142490885 CTGATACTGCAGAGTCCAAAGGG - Intergenic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1036099977 8:5769594-5769616 CTGATACTGCAAAAAGCCAGAGG - Intergenic
1036384834 8:8270020-8270042 CTGATATTCCAGAAACCAGAGGG + Intergenic
1036750319 8:11439748-11439770 CTGGCACTGCATAAACCACGTGG + Intronic
1036989545 8:13577139-13577161 CTGTTACTGGAGAAACAGTGGGG + Intergenic
1039009403 8:33076027-33076049 CTGAAACTGGAGAAACAAAGAGG - Intergenic
1044192718 8:89338403-89338425 CTGATACTGCAGAAACTTGAAGG - Intergenic
1044518942 8:93175613-93175635 CTGAGACAGCAGACACCAAGTGG - Intergenic
1045351918 8:101349181-101349203 CTGCAAATGTAGAAACCATGTGG - Intergenic
1045713123 8:105009872-105009894 CTGGGACTACAGAACCCATGTGG + Intronic
1046177035 8:110590041-110590063 CTTATACTGCAGGCAGCATGTGG - Intergenic
1046676978 8:117120497-117120519 CTGAAACAGAAGAAACCATAGGG + Intronic
1047711751 8:127559426-127559448 ATGAAACTGCAGAAGCCATCTGG + Intergenic
1048000048 8:130371673-130371695 CTGACACTCCAGCAACCATTTGG + Intronic
1048537712 8:135312986-135313008 CTGAGACTGCACAAAGCAGGGGG + Intergenic
1048906392 8:139093272-139093294 CTGTTCCTCCAGCAACCATGGGG - Intergenic
1050248477 9:3717360-3717382 CTGATACTGCAGAAATTCAGAGG + Intergenic
1050708792 9:8435398-8435420 CTGATACAACAGATACCAAGAGG + Intronic
1052182791 9:25550981-25551003 CTGAGACTGAAAAAACCCTGAGG - Intergenic
1052194055 9:25690704-25690726 CAGTTACTGCATAAACCAGGTGG - Intergenic
1055822114 9:80278181-80278203 CTGATACTGCAGATCCCTGGGGG - Intergenic
1056070907 9:82985645-82985667 CTGATATTGGAGAAACCCTGAGG + Intronic
1057885334 9:98825448-98825470 CTGACACTGCAGAAATGGTGGGG - Intronic
1060497286 9:124127877-124127899 CTAATACAGCAGAAAGAATGTGG - Intergenic
1061592250 9:131605183-131605205 CTTATACTACAGAATCCAGGTGG + Intronic
1062203560 9:135321946-135321968 ATGACACTGCAGAAACCCTCTGG - Intergenic
1186474265 X:9845071-9845093 CTGCTACTGCAACAACCCTGAGG - Intronic
1187210018 X:17220606-17220628 CTGACACTGCAGAAAGAAAGAGG - Intergenic
1188122755 X:26329549-26329571 CTGAGAATGAAGAAAACATGTGG + Intergenic
1188745439 X:33835643-33835665 CTGATACTGCAGAAATTCAGAGG - Intergenic
1189058288 X:37723790-37723812 CTTATACTGGAGAAAACATAAGG + Intronic
1189858293 X:45246405-45246427 CTGATACTGCAGAAATTAAAAGG - Intergenic
1191052445 X:56208296-56208318 CTGATACTGCAGAAATTCTAAGG - Intergenic
1191801223 X:65082438-65082460 CTGATACTGCAGAAATTCAGAGG + Intergenic
1193194549 X:78616087-78616109 CTGATACTGCAGAAATTCTTAGG - Intergenic
1193252863 X:79312960-79312982 CTGATACTGCAGAAATTCAGAGG + Intergenic
1193302536 X:79907425-79907447 CTGATACTGCAGGAATCAAAAGG + Intergenic
1193337091 X:80303165-80303187 CTGATACTGCAGAAATGCAGAGG - Intergenic
1194437817 X:93890760-93890782 CTGATACTGCAGAAACTCAAAGG - Intergenic
1194953719 X:100155339-100155361 CTGATACTGCAGAAATTCTAAGG - Intergenic
1195075201 X:101320374-101320396 CTGATACTGCAGAAACTCAAAGG - Intergenic
1195959727 X:110373355-110373377 CACATAATGCAGAAACCCTGGGG + Intronic
1196232181 X:113236977-113236999 CTGATACTGCAGAAATTCAGAGG - Intergenic
1197126448 X:122951959-122951981 CTGATACTGCAGAAATCCTCAGG - Intergenic
1197810729 X:130440646-130440668 CTGATACTGCAGAAACCCAAAGG - Intergenic
1198190785 X:134303160-134303182 CTGATACTGCAGAAATTCAGAGG + Intergenic
1198665723 X:139020273-139020295 TTGAGACTGCATAACCCATGGGG + Intronic
1199247967 X:145629453-145629475 CTGATACTGCAGAAATTCAGAGG + Intergenic
1200709043 Y:6467506-6467528 CTCATCCTACAGAAATCATGTGG + Intergenic
1201025069 Y:9697203-9697225 CTCATCCTACAGAAATCATGTGG - Intergenic
1201372291 Y:13278623-13278645 CTGGGAGTACAGAAACCATGTGG + Intronic
1202183011 Y:22155639-22155661 CTCATCCTACAGAAATCATGTGG + Intergenic
1202208348 Y:22430762-22430784 CTCATCCTACAGAAATCATGTGG - Intergenic