ID: 1080643909

View in Genome Browser
Species Human (GRCh38)
Location 11:34174513-34174535
Sequence GCCATGTGCACAGCCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080643905_1080643909 0 Left 1080643905 11:34174490-34174512 CCCGCTCTGTGCCACCAGGGGAC 0: 1
1: 0
2: 0
3: 29
4: 325
Right 1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 253
1080643900_1080643909 20 Left 1080643900 11:34174470-34174492 CCGGGGCGCCGCTCATGAGGCCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 253
1080643901_1080643909 12 Left 1080643901 11:34174478-34174500 CCGCTCATGAGGCCCGCTCTGTG 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 253
1080643906_1080643909 -1 Left 1080643906 11:34174491-34174513 CCGCTCTGTGCCACCAGGGGACG 0: 1
1: 0
2: 1
3: 16
4: 141
Right 1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 253
1080643899_1080643909 21 Left 1080643899 11:34174469-34174491 CCCGGGGCGCCGCTCATGAGGCC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080643909 Original CRISPR GCCATGTGCACAGCCTGTGC TGG Intronic
900798682 1:4724671-4724693 GCCAGGGGCACAGCAGGTGCAGG - Intronic
902057348 1:13612631-13612653 CCCATGGGCTCAGCTTGTGCAGG + Intronic
902097974 1:13962168-13962190 GCTGTGGGAACAGCCTGTGCCGG + Intergenic
903235038 1:21944647-21944669 GCCATGTGCTGTGCCTGAGCGGG - Intergenic
903558296 1:24209274-24209296 GCCATGTTCTGATCCTGTGCAGG + Intergenic
903658145 1:24961251-24961273 GCCAGTGCCACAGCCTGTGCAGG - Intronic
905110449 1:35590630-35590652 GCCAGGTGCACGGCCTCTCCTGG - Exonic
905895234 1:41541453-41541475 GCGATGTGGACAGCCTGTCACGG - Intronic
906381009 1:45332178-45332200 GCCCTGTGGAGAGCCTGTGCCGG - Exonic
906381315 1:45333594-45333616 CCCTGATGCACAGCCTGTGCAGG - Exonic
906530792 1:46522862-46522884 GGCCTCTGCACAGCATGTGCTGG + Intergenic
906730824 1:48079676-48079698 GACATGAGGACAGCTTGTGCTGG - Intergenic
907243418 1:53092923-53092945 GCCATGTGCTGAGCCTGGGCCGG - Intronic
909084211 1:71152395-71152417 TACATGTGCACAACGTGTGCAGG - Intergenic
909523312 1:76594053-76594075 GCCATGTTCAAAGCCAGTCCAGG - Intronic
911179988 1:94851796-94851818 GCCAAGTGCACAGAATGTGCTGG + Intronic
921892930 1:220370973-220370995 TCCATCTGCAGAGCCTATGCTGG - Intergenic
922765527 1:228154592-228154614 GCCATGTGGACACTCTGTACTGG - Intronic
922856311 1:228777858-228777880 GCCTGGGGAACAGCCTGTGCAGG + Intergenic
923102588 1:230828040-230828062 GCCTTGTGCCCAGCCTGGACAGG + Intergenic
1062920331 10:1274237-1274259 GCCATGGCCACTGCCTGAGCTGG - Intronic
1063313066 10:4973524-4973546 GACATGTGCAAAGCCTTTTCAGG + Intronic
1064029700 10:11876003-11876025 GTCATGCGCGCAGGCTGTGCAGG - Intergenic
1064596947 10:16954850-16954872 GCCATGCCCACAACATGTGCTGG + Intronic
1067478556 10:46581343-46581365 GCCATGTACAGAACTTGTGCTGG + Intronic
1067616181 10:47760458-47760480 GCCATGTACAGAACTTGTGCTGG - Intergenic
1070954950 10:80457641-80457663 GCTATGTGCCCAGGCTGTGCTGG - Intronic
1071525354 10:86355098-86355120 GCCCTGTGCTCACCCTGGGCTGG + Intronic
1072655909 10:97330346-97330368 GCCATTTGCAAAGCCTGTGGAGG - Intergenic
1073989523 10:109246511-109246533 GCTATGTGAACGGCCTGTGAGGG + Intergenic
1075171068 10:120115060-120115082 GACCTGTGCACAGACTGGGCAGG + Intergenic
1075783277 10:125031121-125031143 TAAATGTGGACAGCCTGTGCTGG + Intronic
1075903853 10:126064141-126064163 GCCAAGTGCCCAGCCTGAACTGG + Intronic
1076031466 10:127162813-127162835 GCACTGTGCATGGCCTGTGCTGG + Intronic
1076479945 10:130778327-130778349 GCCCTGGGGAGAGCCTGTGCAGG + Intergenic
1077195794 11:1279342-1279364 GCCATGTGCCTGGCCTGAGCCGG + Intronic
1077334720 11:1998170-1998192 GCCATGTGCAAAGTATGTGCAGG - Intergenic
1077555991 11:3226363-3226385 GCCCTGTGCAGATCCTGGGCTGG + Intergenic
1077560032 11:3254363-3254385 GCTATTTCCACATCCTGTGCAGG + Intergenic
1077565925 11:3300166-3300188 GCTATTTCCACATCCTGTGCAGG + Intergenic
1077579373 11:3407139-3407161 GCCAAGGGCTCAGCTTGTGCTGG - Intergenic
1077698635 11:4418871-4418893 GCCATGAGCACTGCCAGAGCAGG - Intergenic
1080643909 11:34174513-34174535 GCCATGTGCACAGCCTGTGCTGG + Intronic
1083248448 11:61448749-61448771 GTCACGTGGAGAGCCTGTGCAGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1083815853 11:65132137-65132159 GCTATGTGGCCAACCTGTGCTGG - Intronic
1084236406 11:67790682-67790704 GCCAAGGGCTCAGCTTGTGCTGG - Intergenic
1084440954 11:69172889-69172911 GGCATGTGCACAGGCAGGGCAGG + Intergenic
1084650299 11:70485685-70485707 CCCATCTGCATAGACTGTGCAGG + Intronic
1084943808 11:72628217-72628239 GCCATGTGCCAGGCCTGCGCCGG + Intronic
1085174410 11:74473756-74473778 GACAGATGCACTGCCTGTGCTGG - Intergenic
1085529782 11:77184416-77184438 GCCACGTGCACAGCAGATGCTGG - Intronic
1087563040 11:99815687-99815709 GCTGTGTGCACACCCTCTGCAGG + Intronic
1088168355 11:106965712-106965734 TCCATGTGCCAGGCCTGTGCTGG - Intronic
1089783576 11:120892140-120892162 GGCATGTGCAAAGGCTGTGGCGG + Intronic
1090022938 11:123143497-123143519 GCCATGTGAACCGCCTATGGGGG + Intronic
1090248305 11:125233511-125233533 GCAGAGTGCCCAGCCTGTGCTGG - Intronic
1090425684 11:126605556-126605578 GCTCTGCTCACAGCCTGTGCTGG + Intronic
1202817703 11_KI270721v1_random:53352-53374 GCCATGTGCAAAGTATGTGCAGG - Intergenic
1091397732 12:163924-163946 GCCCTGTGCACTCCCTGTCCTGG - Intronic
1091582244 12:1797041-1797063 GCCCTGGGCACCGCCTGAGCAGG + Intronic
1091790605 12:3269905-3269927 CCCGCGTGCACAGCCTGTCCTGG + Intronic
1096519359 12:52175560-52175582 GCCCTGTGGGCAGCCTGTCCGGG + Intronic
1097144172 12:56928568-56928590 GCCATGTCCCAAGCCTGTGTGGG - Intronic
1100799068 12:98212455-98212477 GCCCTGTGCACAGCGTCAGCAGG + Intergenic
1101235037 12:102780213-102780235 GCCATGTGTACAGCATGTTATGG - Intergenic
1101262571 12:103047828-103047850 GCCATGTGAACAAACTGGGCTGG - Intergenic
1101751541 12:107586333-107586355 CCCAGGTGCTCAGCCTTTGCAGG - Intronic
1102175248 12:110869135-110869157 GCCCCGTGCAGAGCCTGGGCTGG - Intronic
1102465531 12:113129054-113129076 ACTATGGGCCCAGCCTGTGCTGG + Intronic
1103404738 12:120667161-120667183 GCCATGTGCCCAGCTGCTGCTGG + Exonic
1103641462 12:122355881-122355903 GCCATCTGCTCAGCCACTGCTGG + Intronic
1103702498 12:122855186-122855208 GCCATCTCCATAGCCTGTGTGGG - Intronic
1104899520 12:132181194-132181216 AGCATGTGCTGAGCCTGTGCTGG - Intergenic
1106837049 13:33645678-33645700 GCCATGTGAACAGCAGGTGTTGG + Intergenic
1109300419 13:60585028-60585050 GCCATGTGATCAGCCTGTGAGGG + Intergenic
1110930894 13:81215277-81215299 GAAATGTGCCCAGCCTTTGCTGG - Intergenic
1111658004 13:91175862-91175884 TCCATGTGCTCACCCTCTGCGGG + Intergenic
1113409459 13:110072262-110072284 GCCTTGAGCACAGTGTGTGCAGG - Intergenic
1113608880 13:111629272-111629294 TCCTTATGCACAGCCTGTTCAGG + Intronic
1114571163 14:23669842-23669864 TCCATGGACACTGCCTGTGCTGG - Intergenic
1116524834 14:45891707-45891729 GCCTTGTGCACAGCATTAGCAGG - Intergenic
1118294531 14:64557030-64557052 GCCATGTGCCCAGGCTGGTCTGG + Intronic
1118750868 14:68807189-68807211 GCCATGTGGACAGCCGGCGGGGG + Intergenic
1118805883 14:69236600-69236622 GCCATATGCAGAGCCTTTGGGGG + Intronic
1119757273 14:77127964-77127986 GCCATTTGCTGAGGCTGTGCAGG + Intronic
1119898100 14:78237916-78237938 TCCTTGTGCCCAGCCTTTGCGGG - Intergenic
1121087777 14:91159821-91159843 GCTATGTGCATAGGCTGTGATGG + Intronic
1121315564 14:92959180-92959202 ACCCTGTGCAGAGCCCGTGCTGG - Intronic
1121733277 14:96201327-96201349 GCCTCCTGCACAGCCTGTGGGGG - Intergenic
1122937671 14:104967471-104967493 GCCCTGGGCACACCCTGTGCTGG + Intronic
1122974978 14:105167391-105167413 GGCATGTGCGCAGCGCGTGCTGG - Intronic
1123007904 14:105333273-105333295 GCCCTGTGCAGAGCAGGTGCTGG + Intronic
1123102998 14:105818418-105818440 GTCAAGTGCACAGGCTGTGCTGG + Intergenic
1125092298 15:35808651-35808673 GCCATGTACACAACCTTTGCTGG + Intergenic
1126047739 15:44659138-44659160 ATCATGTCCACTGCCTGTGCAGG + Exonic
1129438957 15:75565191-75565213 GCCATTTCCACACCCTTTGCAGG - Intronic
1129892592 15:79081481-79081503 GCCCAGTGCAGAGCCAGTGCAGG - Intronic
1132549627 16:548956-548978 GCCATGTGCTCAGGCTGGGCAGG - Intronic
1132565133 16:618761-618783 GCCATGTGTGCAGTGTGTGCAGG + Intronic
1132565168 16:619002-619024 GCCATGTGTGCAGTGTGTGCAGG + Intronic
1132649629 16:1014615-1014637 GCCCTGAGCAGGGCCTGTGCCGG + Intergenic
1134207678 16:12251044-12251066 GCCATGTGGCCAGGCTGCGCAGG + Intronic
1136403611 16:30031085-30031107 GCCATGTGCGGTGTCTGTGCCGG - Exonic
1136902213 16:34051294-34051316 ACTTGGTGCACAGCCTGTGCAGG - Intergenic
1138157319 16:54718113-54718135 GACATGTGCACATGCGGTGCAGG + Intergenic
1141517330 16:84554298-84554320 GCCATGTTCACTGTCTGAGCTGG + Intergenic
1141955119 16:87365590-87365612 GAGATGTTCACAGCCCGTGCAGG - Intronic
1143995606 17:11003877-11003899 ACCATGTGCAAGGCCTCTGCTGG - Intergenic
1144077364 17:11731432-11731454 TACATGTGCACAACGTGTGCAGG + Intronic
1144530620 17:16035376-16035398 GCCATGTTCACAGCATCTTCAGG + Intronic
1144788119 17:17843082-17843104 ATCATCTGCAGAGCCTGTGCTGG - Intergenic
1144824904 17:18100318-18100340 GCTCTGTGGACAGCCTGTGAGGG + Intronic
1144968759 17:19093981-19094003 GCCATGTGCTCAAGGTGTGCAGG - Exonic
1145808231 17:27749891-27749913 GCCAGGTGCACAGTCTGACCTGG - Intergenic
1145940198 17:28739352-28739374 ACTATGTGCACACCCTGTGCTGG + Intronic
1146977360 17:37125711-37125733 GCCCTGGGCACAGACTGTGGTGG - Exonic
1149056742 17:52375945-52375967 GCCAGATGCACAACCTGTACTGG + Intergenic
1152164964 17:78697688-78697710 GCCATGCACACTGCCTGTGGGGG + Intronic
1153308137 18:3651464-3651486 GCCATGTGCTCAGCGTGTCAAGG - Intronic
1155214052 18:23627049-23627071 GCCATGTGCAGGCCATGTGCAGG + Intronic
1157542492 18:48521641-48521663 TTCATTTGCACAGCCTGTACTGG + Intergenic
1157555155 18:48608719-48608741 AGCCTGTGCACAGCCTGTTCTGG + Intronic
1159213664 18:65362847-65362869 ACCTTGTGCCCAGCCTGTGATGG + Intergenic
1159524314 18:69568192-69568214 GCCATATGCACAGCGTCAGCAGG + Intronic
1159644194 18:70898179-70898201 ACCATGTGTACAGCCTGAGGGGG - Intergenic
1160243777 18:77141386-77141408 GCCAGGTCCACAGCCTGAGAAGG + Intergenic
1161544648 19:4872959-4872981 GCTGTGTGCCAAGCCTGTGCTGG + Intergenic
1162064793 19:8118896-8118918 GCCAAGGGCACTGCCTGTGAGGG - Exonic
1162250197 19:9435847-9435869 GCATTGTGCACATCCTGTGGGGG - Intergenic
1163592709 19:18203455-18203477 GACGTGTGGACCGCCTGTGCAGG - Intronic
1164183189 19:22837741-22837763 GACATGTGCACAGCCCTTCCAGG + Intergenic
1166075298 19:40410584-40410606 GCCACGCGCCCAGCCCGTGCTGG - Intronic
1166219854 19:41357338-41357360 GCCCTGTGTCCAGCCTGTGTTGG - Intronic
1167110950 19:47460802-47460824 TCCATGTGCCAGGCCTGTGCTGG - Intronic
1167798030 19:51723307-51723329 GCCACGTGGACATCCTTTGCTGG - Intronic
1168397494 19:56061387-56061409 GCCATTTCCACAGCCTGGGGAGG - Exonic
926231672 2:11008943-11008965 GCCATGTGCATAACCTGTCTGGG - Intergenic
926808742 2:16737759-16737781 GCCATGTTCAAAGGCAGTGCTGG + Intergenic
926973613 2:18491331-18491353 GAAATGTGCCCAGACTGTGCTGG - Intergenic
929270206 2:39963546-39963568 GGCATGTGCACAGCCTCACCAGG - Intergenic
930608582 2:53517259-53517281 GCCATGTAGTCAGCCTGTGAAGG - Intergenic
931356817 2:61544351-61544373 CCACTGTGCCCAGCCTGTGCCGG + Intergenic
931656827 2:64517106-64517128 GACCTGTGCAGAGGCTGTGCTGG - Intergenic
931985580 2:67738755-67738777 GCCATGTGCATAGCTTATGCAGG + Intergenic
932336556 2:70934974-70934996 ACTATGTGCACAGCCTGGCCTGG - Intergenic
933383739 2:81583756-81583778 GCCCTGGGCGCAGCCTGAGCAGG + Intergenic
933779336 2:85790689-85790711 GCCATGTGCAGGGACTGTGTTGG + Intergenic
934080172 2:88460825-88460847 GCCTTGTCCACACTCTGTGCTGG + Intergenic
934577616 2:95412963-95412985 CCTATGTGCAGGGCCTGTGCAGG - Exonic
934639907 2:96021666-96021688 CCTATGTGCAGGGCCTGTGCAGG - Intergenic
936292018 2:111233493-111233515 GCAATGTGCTCACCCTGTGCTGG + Intergenic
936529194 2:113263603-113263625 GGCATGTGCACAGCCAGTTAGGG + Intronic
936687202 2:114841737-114841759 TCCATGTCCCCATCCTGTGCTGG - Intronic
937686157 2:124699511-124699533 GTCAAGTGAACAGGCTGTGCTGG + Intronic
938157182 2:128951735-128951757 GCCCTGTGGATTGCCTGTGCTGG + Intergenic
940059070 2:149545119-149545141 TACATGTGCACAGTGTGTGCAGG + Intergenic
941052434 2:160749786-160749808 GCCATGTGCACAGGCAGAGTGGG - Intergenic
942326099 2:174778389-174778411 TCAAGGTGCACAGCCTGTGTGGG - Intergenic
948182488 2:235993412-235993434 ACCACGTGCACACACTGTGCTGG - Intronic
1169349801 20:4858967-4858989 GCCTTTGGCACAGGCTGTGCAGG + Intronic
1170550330 20:17470870-17470892 GCCAGTTGCACTGCCTGTGAGGG - Intronic
1170800261 20:19584631-19584653 GTCATCTGCACAGCCCCTGCGGG + Intronic
1171159054 20:22905087-22905109 GCCATTTGCCCAGCCCTTGCTGG + Intergenic
1171457649 20:25280971-25280993 GCGATGTGGACCGCCTGCGCAGG + Exonic
1172823047 20:37755835-37755857 ACCATGTGGACAGCATGTGTGGG - Intronic
1173460760 20:43241497-43241519 GTCATGTGCCTAGCCTATGCAGG + Intergenic
1173813449 20:45970256-45970278 ACCATGTGCTCAGCGTGTGCTGG - Intronic
1173857275 20:46258478-46258500 CCCATGTGCCCAGACTGTGACGG + Intronic
1173963579 20:47093717-47093739 GCCCTGTGCACAGCGTCAGCAGG + Intronic
1175316803 20:58054344-58054366 GCCTTGGGCCAAGCCTGTGCTGG + Intergenic
1175654289 20:60755052-60755074 GCCATAGCCACAGCCTCTGCAGG - Intergenic
1175833410 20:61979235-61979257 ACCATGGGCACAGCCCGTGAGGG - Intronic
1177998439 21:28131365-28131387 GCCATGTCCTAAGGCTGTGCAGG + Intergenic
1178335147 21:31735880-31735902 GCCATTTGCACAGCTACTGCTGG + Intergenic
1178722833 21:35025463-35025485 GCCACGTGCATAGCCTGTTGGGG - Intronic
1178727795 21:35070351-35070373 GAAATGTGTACAGCCTCTGCAGG + Intronic
1178748053 21:35272539-35272561 GCCATCTGGAAAGGCTGTGCTGG + Intronic
1179162128 21:38907315-38907337 GACGTGTGCACTGCCTGGGCTGG - Intergenic
1179613096 21:42564980-42565002 GCCACGTGCACAGCTGCTGCTGG + Intronic
1179790806 21:43754925-43754947 GCCCTCTGCACACCCTGAGCTGG + Intronic
1179981568 21:44898541-44898563 GCCATGTGTTCAGCCTGAGCAGG - Intronic
1180940367 22:19656800-19656822 GCCTTCCTCACAGCCTGTGCAGG + Intergenic
1181017611 22:20080285-20080307 GCCATCTGGAAAGCCTGTCCAGG - Exonic
1183522382 22:38303066-38303088 GCCATGAGCACAGGGTGGGCCGG - Intronic
1184127177 22:42495882-42495904 GCTATGGGCACAGCCAGAGCTGG - Intergenic
1184134287 22:42537518-42537540 GCTATGGGCACAGCCAGAGCTGG - Intergenic
1184134567 22:42539527-42539549 GCTATGGGCACAGCCAGAGCTGG - Intergenic
1184248280 22:43246502-43246524 GCCCTGTGCAAAGCCTGGGGAGG + Intronic
1184461512 22:44640469-44640491 GCTCCGTGGACAGCCTGTGCAGG + Intergenic
1184839985 22:47046858-47046880 GCCAGGTGCAGGGCCTGTGCAGG + Intronic
1184854086 22:47136957-47136979 GCCACCTGCACAGCATGGGCTGG - Intronic
949921939 3:9009932-9009954 GCTCTGTGCCAAGCCTGTGCTGG - Intronic
954219441 3:49144057-49144079 GCCATGTGGACAGCATGAGTGGG - Intergenic
956039000 3:65126159-65126181 TACATGTGCACAACGTGTGCAGG - Intergenic
959692214 3:109209936-109209958 GCCTTTTGCTCTGCCTGTGCCGG + Intergenic
961302494 3:125931090-125931112 GCCAAGGGCTCAGCTTGTGCTGG + Intronic
961379606 3:126488313-126488335 GCCAGGTGCCCACCCAGTGCAGG - Intronic
961434725 3:126909102-126909124 ACGGTGTGCACAGGCTGTGCTGG - Intronic
961476433 3:127149739-127149761 GCCCTGTGCCCAGCCTGGGAGGG - Intergenic
961555816 3:127696115-127696137 GCCTTGGGCACAGCCTGTCAGGG - Intronic
961667037 3:128498939-128498961 CCCATGGGCACAGCGGGTGCAGG - Intergenic
968982014 4:3855386-3855408 GTCAAGTGAACAGCCGGTGCTGG + Intergenic
973603309 4:52562618-52562640 ACCATGTGCTCAGCATCTGCTGG - Intergenic
976207890 4:82639633-82639655 CCCAGGTCCTCAGCCTGTGCAGG - Intronic
977160076 4:93623189-93623211 TACATGTGCAGAACCTGTGCAGG + Intronic
978066586 4:104411702-104411724 GCCATGAGCACTGCATCTGCAGG - Intergenic
981678415 4:147365979-147366001 GCCATGTGCATGGCCTGTTTGGG + Intergenic
984998694 4:185463627-185463649 TCCTCGTTCACAGCCTGTGCTGG + Intronic
985871266 5:2558917-2558939 GTCATCAGGACAGCCTGTGCTGG - Intergenic
986231273 5:5866769-5866791 GCCATGTGCAGAGCCCGGTCTGG + Intergenic
986821048 5:11467182-11467204 CTCCAGTGCACAGCCTGTGCTGG - Intronic
991204809 5:64038509-64038531 GCAGTGTCCAGAGCCTGTGCAGG - Intergenic
992266155 5:75020237-75020259 GCCCCGTGCACAGCATCTGCAGG - Intergenic
995908227 5:117152874-117152896 GACATATGCACAGACTGTGGTGG + Intergenic
996346919 5:122497657-122497679 GCCATGTGAAAAGCCTTTTCTGG + Intergenic
997844694 5:137275984-137276006 GCAGTGTGAACAGCCTGGGCAGG - Intronic
998807110 5:145928861-145928883 TACATGTGCACAACATGTGCAGG - Intergenic
999467328 5:151820106-151820128 GCCATTTGCCCAACCTCTGCTGG - Intergenic
1001806287 5:174589553-174589575 GCCATCTGCTCTGCCTGGGCTGG + Intergenic
1001922112 5:175609028-175609050 GGAATGTGCAGAGCCTGGGCTGG - Intergenic
1002090738 5:176804241-176804263 GGCATGTGAACAGTGTGTGCAGG + Intergenic
1003530377 6:6931857-6931879 GCCAGGTTCAGAGACTGTGCAGG - Intergenic
1004232017 6:13842270-13842292 GTCATGTAGACAGCCTCTGCGGG - Intergenic
1005843496 6:29759911-29759933 CCCATGTGCAGAGGCTGTCCTGG - Intergenic
1008265363 6:49418582-49418604 GACATCTGCACAGACTGTGCTGG - Intergenic
1008427804 6:51379766-51379788 CCCATGCCCACAGCTTGTGCAGG - Intergenic
1012986345 6:105880395-105880417 GCCACCTTCCCAGCCTGTGCCGG + Intergenic
1013162671 6:107560803-107560825 GCCATGTTCACGGCCTCTGTTGG + Intronic
1013419252 6:109951206-109951228 ACTGTGTGCCCAGCCTGTGCTGG + Intergenic
1013454236 6:110315730-110315752 GCCATGTGCACAGGGTGTGCAGG + Intronic
1014450057 6:121572088-121572110 GCCATGTCCTGAGGCTGTGCAGG - Intergenic
1017548332 6:155476065-155476087 GGTATGTGCACAGGATGTGCAGG - Intergenic
1018536597 6:164827055-164827077 GCCCTGTGCACAGCATCAGCAGG - Intergenic
1019147125 6:169982729-169982751 CCCATGGCCACAGCCTGAGCAGG + Intergenic
1019147672 6:169985389-169985411 CCCATGGCCACAGCCTGAGCAGG - Intergenic
1019187342 6:170228435-170228457 GCCTGGTGCACAGCCAGTGCGGG - Intergenic
1019972143 7:4549788-4549810 GCCCAGTGCCCAGCCTGGGCTGG + Intergenic
1020319423 7:6929160-6929182 GCCAAGGGCTCAGCTTGTGCTGG - Intergenic
1024587860 7:50856833-50856855 TCACTGTCCACAGCCTGTGCCGG - Intergenic
1024587912 7:50857085-50857107 TCACTGTCCACAGCCTGTGCCGG + Intergenic
1024984632 7:55184196-55184218 GCCATGTGCTGGGCCTGTGGTGG - Intronic
1027520845 7:79204463-79204485 GCCCTGTGCAAATGCTGTGCTGG - Intronic
1030549228 7:110937316-110937338 GCCATATTCACAGCCTGAGAAGG - Intronic
1033471796 7:141656637-141656659 TCCATGAGCAGAGCCTGTGGGGG - Intergenic
1033514583 7:142093502-142093524 ACAATGTGCACAACCTGTACGGG + Intronic
1035101106 7:156397330-156397352 GCGATGCGCACAGGCAGTGCCGG - Intergenic
1035226812 7:157438300-157438322 GCCATGTGTCCAGCCCTTGCTGG + Intergenic
1035282143 7:157785155-157785177 CCCCTGTGGAGAGCCTGTGCTGG - Intronic
1035334746 7:158120758-158120780 GCCATCTGAACAGCTTGTGAAGG + Intronic
1039314260 8:36354425-36354447 TCCATGTTTACAGCATGTGCTGG + Intergenic
1039966889 8:42290291-42290313 GCCAGGTGCACAGCCTGTCTGGG + Intronic
1040104480 8:43533863-43533885 CCCATGTCCTCAGCCTGTGCTGG + Intergenic
1041196839 8:55409180-55409202 GCCATGTGTAAACCCTGTGTTGG + Intronic
1041380459 8:57249261-57249283 TCCATGTGCTAAGGCTGTGCTGG + Intergenic
1044449619 8:92319247-92319269 TCCATCTGCACAACCTGAGCAGG - Intergenic
1045498504 8:102728024-102728046 ACTAGGTGCAGAGCCTGTGCAGG - Intergenic
1046573242 8:115992987-115993009 ACCACCTGCACAGCTTGTGCTGG + Intergenic
1048458708 8:134602031-134602053 GCCAGGTGCACAGCTGGGGCAGG + Exonic
1048875493 8:138834031-138834053 GGAATGTGGACAGCGTGTGCTGG - Intronic
1049235891 8:141512129-141512151 GCCATGTGCCCAGCATCTGGAGG - Intergenic
1049349288 8:142155373-142155395 GCCATGTTTACAGCGTGTCCTGG - Intergenic
1049387699 8:142352490-142352512 GCCATGGGCACAGGCTGTGAGGG + Intronic
1050361718 9:4836803-4836825 GCCATGTGCAGAGAGAGTGCTGG + Intronic
1052833477 9:33233845-33233867 GCCAGCTCCACAGCCTGTCCTGG - Intronic
1055674979 9:78648849-78648871 GATATGTGCACAGAATGTGCAGG - Intergenic
1056013136 9:82353769-82353791 ACCATGTGTGCAGCCTGTTCTGG + Intergenic
1056426785 9:86485375-86485397 GCCACGAGCACAGTCTGTGCTGG - Intergenic
1057114481 9:92507603-92507625 GCCATGTCCACAGCCTGTCATGG - Intronic
1060301194 9:122375537-122375559 ACTGTGTGCATAGCCTGTGCTGG + Intronic
1060773165 9:126347280-126347302 GCCTTGGGCTCGGCCTGTGCGGG + Intronic
1060789061 9:126473550-126473572 GCCATGTGATGAGCCTGTTCTGG - Intronic
1062367296 9:136216926-136216948 GCCGTGGGCACAGGCTGTCCTGG - Intronic
1186673747 X:11794101-11794123 GCCACGTGCAGAGCTTCTGCTGG - Intergenic
1186711227 X:12199498-12199520 TACCTGTGTACAGCCTGTGCAGG + Intronic
1188919716 X:35957813-35957835 GCCATTTGACCAGTCTGTGCAGG - Intronic
1189266243 X:39718844-39718866 GCTGTGGGCAGAGCCTGTGCTGG - Intergenic
1191975027 X:66862187-66862209 GCCATAAGCACAGCCAGTTCAGG - Intergenic
1199703526 X:150404120-150404142 GCCATGTGGGCTGCCTGTGGTGG - Intronic
1199945051 X:152658560-152658582 GGCCTGTTCCCAGCCTGTGCAGG - Intergenic