ID: 1080644792

View in Genome Browser
Species Human (GRCh38)
Location 11:34180689-34180711
Sequence GCGCCTTGCTCAAGGTTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080644782_1080644792 26 Left 1080644782 11:34180640-34180662 CCACCTCCTCTCATTGCTAGAGG 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG 0: 1
1: 0
2: 2
3: 48
4: 311
1080644786_1080644792 20 Left 1080644786 11:34180646-34180668 CCTCTCATTGCTAGAGGAGGAAA 0: 1
1: 0
2: 1
3: 22
4: 200
Right 1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG 0: 1
1: 0
2: 2
3: 48
4: 311
1080644789_1080644792 -9 Left 1080644789 11:34180675-34180697 CCCAGAGAGGCTAAGCGCCTTGC 0: 1
1: 3
2: 13
3: 141
4: 788
Right 1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG 0: 1
1: 0
2: 2
3: 48
4: 311
1080644790_1080644792 -10 Left 1080644790 11:34180676-34180698 CCAGAGAGGCTAAGCGCCTTGCT 0: 1
1: 0
2: 6
3: 71
4: 420
Right 1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG 0: 1
1: 0
2: 2
3: 48
4: 311
1080644784_1080644792 23 Left 1080644784 11:34180643-34180665 CCTCCTCTCATTGCTAGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG 0: 1
1: 0
2: 2
3: 48
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080644792 Original CRISPR GCGCCTTGCTCAAGGTTACA CGG Intronic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901797718 1:11690502-11690524 GCGACTTGCTCGAGGTCATAGGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902431034 1:16363323-16363345 GAGACTTGCCCAAGGTCACAAGG + Intronic
902564732 1:17303917-17303939 GCACCAGGCTCAAGGTCACACGG - Intergenic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903239621 1:21974228-21974250 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903243429 1:21999156-21999178 GGGACTTGCTCAAGGTCACCTGG + Intergenic
903301258 1:22380159-22380181 GTCCCTTGCCCAAGGTCACAAGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903424823 1:23245804-23245826 TGACCTTGCTCAAGGTCACACGG - Intergenic
903642263 1:24868067-24868089 GCGGCTTGCCCAAGGCTACACGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903885624 1:26539475-26539497 ATGACTTGCCCAAGGTTACAAGG - Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
904807569 1:33142569-33142591 GAGACTTGCTCAGGGTCACATGG + Intergenic
905334264 1:37233348-37233370 GCGGCTTGCTCAAGGTCATTTGG - Intergenic
906479684 1:46191981-46192003 GCTCTTTCCCCAAGGTTACATGG + Intronic
907492390 1:54816373-54816395 GCAACTTGCCCAAGGTAACACGG - Intronic
907775924 1:57514792-57514814 GTTCCTTGCCCAAGGTGACAGGG - Intronic
907803977 1:57800118-57800140 GCAACTTGGCCAAGGTTACATGG + Intronic
910882021 1:91930272-91930294 GCCTCTTGCTCAGGTTTACAGGG - Intergenic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913186736 1:116375214-116375236 GTGACTTGCTCAAGGTCAAACGG + Intronic
913201545 1:116498717-116498739 AAGGCTTGCTCAAGGTCACATGG + Intergenic
913445016 1:118941864-118941886 GTGACTTGCTTAAGGTTAGATGG - Intronic
915063471 1:153205570-153205592 GCAACTTGCCTAAGGTTACAAGG - Intergenic
915538351 1:156551437-156551459 GGGATTTGCTCAAGGTCACATGG + Intronic
915725214 1:158012366-158012388 GTGACTTGCACAAGGTCACACGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916870265 1:168906348-168906370 GTAACTTGCTCAAGGTTAGACGG - Intergenic
916893762 1:169139495-169139517 GTAACTTGCTCAAGGTTACCTGG - Intronic
917724885 1:177818894-177818916 GTGACTTGCTCAGGGATACATGG - Intergenic
917818929 1:178740858-178740880 GCGATTTGCCCAAGGTTGCAGGG - Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
922021704 1:221711636-221711658 ATAACTTGCTCAAGGTTACAAGG - Intronic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
1063374272 10:5544468-5544490 ATAACTTGCTCAAGGTTACATGG - Intergenic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1067558056 10:47285935-47285957 GCTCCTTCCTCAAGGCTACAGGG - Intergenic
1068605976 10:59005468-59005490 GTGATTTGCCCAAGGTTACAGGG + Intergenic
1069821806 10:71233127-71233149 CAACCTTGCTCAAGGTCACAGGG - Intronic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1071980275 10:90998456-90998478 CGGCCTGGCCCAAGGTTACAGGG + Intergenic
1073166079 10:101453518-101453540 GCATCTTGCTCAAGGTTGGATGG - Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1074187848 10:111112698-111112720 GTAACTTGCCCAAGGTTACATGG + Intergenic
1074392193 10:113067718-113067740 AAGACTTGCTCAAGGTCACATGG - Intronic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1075211407 10:120494360-120494382 GCACCTTGCCCAAGGTCACGTGG + Intronic
1075736555 10:124667945-124667967 GCGACTTGCTCAGGGCTACTCGG + Intronic
1075737995 10:124675819-124675841 GGGCCTTGCCCAAAGTCACATGG - Intronic
1075931351 10:126299466-126299488 GCAACTTGCCCAAGGTTACCTGG + Intronic
1076934458 10:133558271-133558293 GGGGCTTGCTCACGGTCACATGG + Intronic
1080644792 11:34180689-34180711 GCGCCTTGCTCAAGGTTACACGG + Intronic
1080691120 11:34558878-34558900 GCGCCTTGCCTGAGGTCACATGG - Intergenic
1081870497 11:46380840-46380862 GGGGCTTGCTCAAGGCCACAGGG - Exonic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1081997593 11:47375317-47375339 GAGACTTGCACAAGGTCACACGG - Intronic
1083488730 11:62999573-62999595 GCACCTTGACCAAGGTCACAGGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083925359 11:65802901-65802923 CCATCTTGCTCAAGGTCACACGG + Intergenic
1084199628 11:67547077-67547099 GCATCTAGCTCAAGGTCACATGG - Intergenic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1085394151 11:76198174-76198196 GTGACTTGCTCAAGGTCGCAAGG - Intronic
1085408160 11:76276324-76276346 GTGCCTTGCCTAAGGTCACATGG + Intergenic
1086931150 11:92694640-92694662 GCTCCTTGCCCAGGGTCACATGG - Intronic
1088727637 11:112653671-112653693 GAGACTTGCTCAGGGTGACATGG + Intergenic
1089085092 11:115810183-115810205 GCGCTTTGCTCTACATTACAGGG - Intergenic
1089134258 11:116236603-116236625 TTATCTTGCTCAAGGTTACATGG - Intergenic
1089256850 11:117198743-117198765 GCGTCTTCCTCAAGGCCACATGG - Intergenic
1089584538 11:119502178-119502200 GTGGCTTGCTCAAGGTTCCTCGG + Intergenic
1089607840 11:119651947-119651969 GGGCCTTGCTCAAGGTCACCTGG + Intronic
1090405605 11:126474374-126474396 GTGACTGGCTCAAGGTCACATGG + Intronic
1090704380 11:129323205-129323227 GTAACTTGCCCAAGGTTACATGG - Intergenic
1091281672 11:134385051-134385073 GCAGCTTGCTCAAGGGCACAGGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091930232 12:4390042-4390064 GTGATTTGCCCAAGGTTACACGG + Intergenic
1093420761 12:18971721-18971743 GAGGCTTGCTCAAGTTCACATGG - Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096302091 12:50438734-50438756 GTAGCTTGCTCAAGGATACAAGG + Intronic
1096598155 12:52710425-52710447 GGGCCAGTCTCAAGGTTACAGGG + Intergenic
1097263000 12:57729986-57730008 GTGCCTTGCTCAAGGTCTTAAGG - Intronic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1099171598 12:79371176-79371198 GAGACTCGCTCAAGGTCACAAGG + Intronic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101253240 12:102955384-102955406 GGGACTTGTTCAAGGTTATAAGG + Intronic
1101548432 12:105738941-105738963 AGGAATTGCTCAAGGTTACAAGG + Intergenic
1101914045 12:108882688-108882710 GCAACTTGCCCAGGGTTACATGG + Intronic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1102638401 12:114344791-114344813 GTGACTTGCTCAAGGTCATAGGG - Intergenic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102716341 12:114976247-114976269 GGGGCTTGCTCAGGGTCACATGG + Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1102920373 12:116787322-116787344 GCGACTTGCTCAAGGCACCATGG - Intronic
1103045182 12:117730211-117730233 TCTCCTTGCTCAAGGGCACAGGG - Intronic
1103174410 12:118849758-118849780 GTGACTTGCACAAGGTCACACGG + Intergenic
1103191510 12:119005907-119005929 GAGCTTTGCCCAAGGTCACACGG - Intronic
1103333395 12:120170710-120170732 GTGTGTTGCTCAAGGTCACACGG + Intronic
1104077206 12:125400614-125400636 GCTCCTTGCAACAGGTTACAGGG - Intronic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1107388036 13:39933666-39933688 GTGACTTGCCCAAGGTTGCACGG - Intergenic
1108014356 13:46058611-46058633 GCCACTTTCTCAAGGTTGCAAGG - Intronic
1108069895 13:46617542-46617564 GAACCTTGTTCATGGTTACAAGG - Intronic
1108269889 13:48749081-48749103 CTGCCTGCCTCAAGGTTACAGGG + Intergenic
1108431750 13:50360410-50360432 GCTCCTAGCTCAGGGTCACACGG - Intronic
1109697531 13:65979424-65979446 GTGTCTTGCCCAAGGTTACACGG - Intergenic
1112362984 13:98733746-98733768 GCACCTTGATCAAGGCCACATGG - Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1120102464 14:80461124-80461146 GTGACTTGCTCAGGGTGACAGGG + Intergenic
1120184760 14:81383227-81383249 GCAACTTGCTCCAGGCTACAGGG - Intronic
1120737302 14:88067087-88067109 GTGACTTGCTCAAGATTACTAGG - Intergenic
1120786136 14:88538775-88538797 GTGACTTGCTCATGGTTACATGG - Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121052334 14:90827749-90827771 ACGCCTTTCACAAGGTCACACGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121812879 14:96907169-96907191 GTGACTTGCACAAGGTTACAAGG + Intronic
1122318902 14:100841548-100841570 GAGCCTTGCCCGAGGTTGCACGG + Intergenic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1126420474 15:48467048-48467070 GGAACTTGCCCAAGGTTACATGG + Intronic
1127202251 15:56667764-56667786 GTTCCTTGTTCAAGGTCACATGG - Intronic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1128171569 15:65517865-65517887 GCGACTTGCTGAAAGTCACAGGG + Intergenic
1128727213 15:69997190-69997212 GCGACCTGCTCAAGGTTAGGTGG + Intergenic
1129521873 15:76191395-76191417 GGGACTTGCTCAAGGCCACAGGG + Intronic
1130323180 15:82856941-82856963 ACTCCTTGCCCAAGGTCACATGG - Intronic
1130960547 15:88656000-88656022 GTGACTTGCTCAAGGTTGCCGGG - Exonic
1133466760 16:6034861-6034883 GTGCTTTGCTTAGGGTTACAGGG + Intronic
1133654265 16:7844617-7844639 GTGACTTGCTCAATGTCACACGG + Intergenic
1133888532 16:9855211-9855233 GTGGCTTGTTCAAGGTCACATGG - Intronic
1135159958 16:20085331-20085353 GCGACTTGGTCAAGGTCACGCGG - Intergenic
1135924312 16:26679096-26679118 ATGACTTGCTCAAGGTCACAAGG - Intergenic
1137576135 16:49601558-49601580 GTGACTTGTTCAAGGTCACAAGG + Intronic
1141283459 16:82649806-82649828 GGGGTTTGCTCAAGGTTACAGGG - Intronic
1141545617 16:84766250-84766272 GTGACTTGTTCAAGGTCACATGG - Intronic
1142047539 16:87935279-87935301 GGGCCTCGTTCAAGGTCACAAGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1144051456 17:11500511-11500533 CTGACTTGCTCAAGGTTCCATGG + Intronic
1145816305 17:27797456-27797478 GGGACTTGCCAAAGGTTACAGGG + Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146927220 17:36753379-36753401 CAGCCTTGCTCAAGGTCACAGGG + Intergenic
1147507940 17:41038973-41038995 GGGACTTGCTCAAGGATTCATGG + Intergenic
1149361448 17:55899753-55899775 CCGACTTGTTCAAGGTTACTAGG + Intergenic
1149545104 17:57497523-57497545 GGGTCTTTGTCAAGGTTACATGG + Intronic
1150722785 17:67627767-67627789 GAGGCTTGCTCAAAGTCACATGG - Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1153583382 18:6597783-6597805 GCACCTTGCTGAAGGTCAAACGG + Intergenic
1155813719 18:30275307-30275329 GTAACTTGGTCAAGGTTACATGG + Intergenic
1158589834 18:58769905-58769927 CTGGCTTGCTCAAGGTCACAGGG + Intergenic
1160040651 18:75342343-75342365 ACGACCTGCTCAAGGTTACGGGG - Intergenic
1161341513 19:3745717-3745739 GCCACTTGCTCAGGGTTGCAGGG - Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1161885101 19:6988482-6988504 GTGGCTGGCTCAAGGTCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166773491 19:45298407-45298429 GTGACTTGCTCAAGGTCACTTGG - Intronic
1168160520 19:54507630-54507652 GGGCCTTGCTCAGGGTCACGTGG - Intronic
925297004 2:2783951-2783973 GGCCCTTGCTCGAGGTCACATGG - Intergenic
925332858 2:3072145-3072167 GGGGTTTTCTCAAGGTTACATGG - Intergenic
927469191 2:23359630-23359652 GTGGCTTGCTGAAGGTTTCATGG + Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928687564 2:33764583-33764605 GCGTCTCACTAAAGGTTACAAGG + Intergenic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930178885 2:48331128-48331150 GTGACTGGCTCAAGGGTACAAGG + Intronic
930355632 2:50315461-50315483 GCTCTTTGCTCACAGTTACATGG + Intronic
930625244 2:53689670-53689692 GGGCATTGCTCAAAGTTTCAAGG + Intronic
931988328 2:67762900-67762922 GTAACTTGCCCAAGGTTACATGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934615349 2:95767298-95767320 GCGCCTTGTTCAAGATCATAGGG + Intergenic
934838960 2:97613350-97613372 GCGCCTTGTTCAAGATCATAGGG - Intergenic
935644804 2:105325398-105325420 GTGGCTTGCTCAAGGTTACCTGG + Intronic
936264126 2:110987543-110987565 GTACCTTGCTCAAGGTTACATGG + Intronic
938105452 2:128526935-128526957 GGGCCTAGCTCAGGGTGACAGGG - Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
945603789 2:211901211-211901233 GTGACTTATTCAAGGTTACAGGG - Intronic
947843894 2:233228325-233228347 GAGCCTTTCTCAAGGTAACTGGG + Intronic
948125775 2:235563902-235563924 GAAGCTTGCTCCAGGTTACATGG + Intronic
948164989 2:235854249-235854271 AGGCCTTGTTCAAGGTCACATGG + Intronic
948321443 2:237072890-237072912 TGGCCTTGCTCAAGGTCACGCGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1169733295 20:8810269-8810291 GCGACGTGTCCAAGGTTACATGG + Intronic
1169788001 20:9381280-9381302 GTTCCTAGCTCAAGGTCACAGGG - Intronic
1172099439 20:32476352-32476374 CAGCCTTGCTCAAGGCTCCAAGG - Intronic
1172331629 20:34079741-34079763 GAGACTTGCCCAAGGTTACATGG + Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172806260 20:37614056-37614078 GCCCCTTGCCCAAAGTTTCATGG + Intergenic
1172822881 20:37753973-37753995 GGGGCTTGCACAAGATTACATGG + Intronic
1173125538 20:40332882-40332904 ACAACTTGCTCAAGGTTATATGG + Intergenic
1173480563 20:43395619-43395641 GTGCCTTGCTCAAGGTTTCAAGG - Intergenic
1173727508 20:45307763-45307785 GTGTCTTGCTGAAGGGTACATGG + Intronic
1173913450 20:46688416-46688438 GTAACTTGCCCAAGGTTACACGG - Intronic
1174162399 20:48560907-48560929 GGGTCTTGCTCAAGGTCACGAGG - Intergenic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174267840 20:49344845-49344867 GTGGCTTGCTCAAGGTCCCATGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1179131103 21:38638174-38638196 GTGACTTGCTCAAGGTCCCATGG - Intronic
1179451801 21:41473249-41473271 GAGACCTGCTCAAGGTCACAGGG + Intronic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181949473 22:26543705-26543727 GCAGCTTGCCCAAGGTTGCATGG + Intronic
1182310149 22:29398580-29398602 GTGACTTGCTCAGGGTCACACGG - Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183670706 22:39270736-39270758 GCCCCTTGCTCAGGGTCACAAGG - Intergenic
1183713213 22:39519088-39519110 GCTTCTTGCTCAAAGTCACAAGG - Intergenic
1183748497 22:39705800-39705822 ATGCCTTGCTCAAGGCCACACGG + Intergenic
1183835682 22:40450927-40450949 GGGACTTGCTGTAGGTTACACGG - Intronic
1184060022 22:42075706-42075728 GGAACTTGCCCAAGGTTACATGG - Intronic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
1185071364 22:48658551-48658573 GCTCCTTCCTGAAGGTTATATGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
950567889 3:13781972-13781994 AGGACTTGCTCAAGGTCACACGG + Intergenic
952507664 3:34022136-34022158 GCAACTTGCCCAAGGTTTCAAGG + Intergenic
952716178 3:36483179-36483201 GTGCTTTGCTCAGGGTTTCAGGG - Intronic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954892335 3:53942532-53942554 GCAAGTTGCCCAAGGTTACAAGG + Intergenic
955204657 3:56884909-56884931 GCAATTTGCTCAAAGTTACATGG + Intronic
955523026 3:59793470-59793492 CAGCCTTGCCCAAGGTCACATGG + Intronic
956510410 3:69987670-69987692 ATACCTTGCTCAAGGTTATAAGG - Intergenic
956594224 3:70948762-70948784 GTGACATGCTCAAGGTTGCATGG - Intergenic
959943090 3:112099953-112099975 GTGACTTGCTCAAGGTCACCTGG + Intronic
960325556 3:116291404-116291426 GCGTCTTGCCCAAGGTTAAATGG - Intronic
961210165 3:125119469-125119491 GGGTCTTGTTCAAGGTTACAGGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961633060 3:128315462-128315484 GGCCCTTGCTCAAGGCCACACGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961658783 3:128457472-128457494 GAGACGTGCTCAAGGTCACAGGG - Intergenic
964143378 3:153429667-153429689 GGGACTTTCTTAAGGTTACACGG + Intergenic
967290734 3:187917368-187917390 GTGCCTTGCACAAGGTCACTTGG - Intergenic
967970332 3:194994629-194994651 GTGACTTGCTCAAAGTCACACGG - Intergenic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969233535 4:5849073-5849095 GTTCCTTGCCCAAGGTCACATGG + Intronic
969974513 4:11084547-11084569 GCCTCTAGCTCAAGGTCACATGG + Intergenic
971066469 4:23038498-23038520 GTGACTTGCCCAAGGTGACATGG + Intergenic
971748724 4:30618874-30618896 GGGATTTGCTCAAGGTTACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972425624 4:38929900-38929922 GTGACTTATTCAAGGTTACAAGG - Intronic
972736672 4:41848750-41848772 GAGGCTTGGTCAAGGTCACATGG + Intergenic
975038944 4:69720802-69720824 GTGACTTGCTCAAGTTTTCAGGG + Intergenic
975472754 4:74789569-74789591 GCAACTTTCTCAATGTTACAAGG + Intronic
981648341 4:147025956-147025978 GTGCCTTCCTTAAGGTCACATGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
986212503 5:5687369-5687391 GTGTCTTGCTCAGGTTTACAGGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
988992670 5:36686827-36686849 GGGACTTGCTCAAGGCCACATGG - Exonic
991416556 5:66398732-66398754 GGGACTTGCTCAAGGATCCAAGG - Intergenic
992663251 5:78982579-78982601 GAAACTTGCCCAAGGTTACAGGG - Intronic
992853406 5:80834937-80834959 GCCACTTCCTCAAGGTGACAGGG - Intronic
992937851 5:81728516-81728538 GTGGCTTGCACAAGGTTATATGG - Intronic
994068462 5:95570489-95570511 GTAACTTGCCCAAGGTTACAAGG - Intronic
996001322 5:118367899-118367921 GTAACTTGCTCAAGGATACATGG - Intergenic
996750736 5:126886214-126886236 GTTCCTTGTTTAAGGTTACATGG + Intronic
997512907 5:134465638-134465660 GTGACTTGCACAAGGTCACACGG - Intergenic
997963625 5:138340394-138340416 GGGCCTTGCTCAAGGGAAAAGGG - Intronic
998028894 5:138846242-138846264 GCGCCTGGCCCAAGGGTACTGGG + Intronic
998094216 5:139388246-139388268 GCCCCTGGCCCAAGGTCACAAGG + Intronic
998151493 5:139759961-139759983 AGGCCTTGCCCAAGGTCACATGG + Intergenic
998167971 5:139855362-139855384 TCAATTTGCTCAAGGTTACATGG + Intronic
998393759 5:141805017-141805039 GAGCTTTGCCCAAGGTCACAGGG - Intergenic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999912851 5:156224190-156224212 GAGCCTTGACCATGGTTACACGG + Intronic
1000020450 5:157314185-157314207 GTGCCTTGCTGAAGGCCACATGG - Intronic
1001960569 5:175878285-175878307 GGGCCTTGCTGAAGGTCCCATGG + Intronic
1002181756 5:177434340-177434362 GCTCCTGGCCCAAGGTCACACGG - Intronic
1002248189 5:177903567-177903589 GAGACTTGTTCAAGGTCACACGG + Intergenic
1006431775 6:34001735-34001757 GTGACTTGCTCAAGGTCTCATGG + Intergenic
1006903596 6:37518387-37518409 GCTGCTTGCTCAAGGATGCACGG - Intergenic
1006969414 6:38025899-38025921 GGTCCTTGCTAAAGGGTACAGGG + Intronic
1007953623 6:45896430-45896452 GAGCCTTGCTCAAGGGCACATGG + Intergenic
1008003091 6:46381296-46381318 GTGACTTGCCCAAGGTTGCATGG - Intronic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1013244429 6:108273373-108273395 ACGCACTGCTCAAGTTTACAAGG - Intergenic
1014927258 6:127287709-127287731 GCTCCATGCTCAAGGTTGAAAGG + Exonic
1015629299 6:135215446-135215468 GCGCCATACTCAAGGTTACCTGG - Intronic
1017447078 6:154516869-154516891 CTGACTTGCTCAAGGTTACAGGG - Intergenic
1018409022 6:163522385-163522407 GTGAGTTGCTCAAGATTACAGGG + Intronic
1018607256 6:165610868-165610890 GCTGCTTGCTAAAGGTCACATGG - Intronic
1019230035 6:170552920-170552942 TCGCTTTGCTCAAGTTTACTTGG - Intronic
1019338432 7:495960-495982 GCCCCTCGGTCAAGGTCACAGGG + Intergenic
1019648177 7:2142016-2142038 GTGCGCTGCTCAAGGTGACAGGG - Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1022045983 7:26622787-26622809 GCATCTTGCTCAAGGTCACTGGG - Intergenic
1023521716 7:41056234-41056256 GCCCTTGGCCCAAGGTTACATGG - Intergenic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1026257591 7:68725960-68725982 GAGACTTGCTGAAGGTTACTTGG + Intergenic
1030542322 7:110846238-110846260 GTGCCTTGGCCAAGGTAACATGG + Intronic
1031927654 7:127653085-127653107 GTGACTTGCTTAAGGTCACATGG + Intronic
1033142778 7:138842323-138842345 GCCCGTTGCTCAGGGTCACATGG - Intronic
1033806334 7:144958565-144958587 GAGACTTGCTCAAGGTCAGATGG - Intergenic
1037167172 8:15845260-15845282 GTGCCTTGCGCAGGGTCACATGG - Intergenic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1038516560 8:28192478-28192500 GGGCCTTGCTCAAAGCTTCATGG - Intergenic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041414282 8:57590168-57590190 GTGACTTGCTCAAAGTAACATGG - Intergenic
1042923424 8:73942197-73942219 GGGCCTTGTTCAAGGTCACATGG + Intronic
1042998064 8:74722841-74722863 GCATCTTGCCCAAGATTACACGG + Intronic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1047325144 8:123828810-123828832 GCACTTTGCCCAAGGTCACATGG - Intergenic
1048156004 8:131952444-131952466 TGCCCTTGCTCAAGGTTAAAGGG - Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1049034908 8:140067658-140067680 GTGACTTGATCAAGGTCACAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1050337425 9:4602807-4602829 GTCCCTTGCTCAAGGTGACATGG - Intronic
1052338383 9:27341772-27341794 GTGACTTGCCCAAGGTTACATGG + Intronic
1054970753 9:71083360-71083382 GCAACTTGCCCAAGGTTACAAGG + Intronic
1055058052 9:72041566-72041588 GGTCCTTGCCCAAGGTCACATGG + Intergenic
1058533880 9:105934435-105934457 GTGACTTGCTCAAGGTCATATGG + Intergenic
1059303914 9:113339303-113339325 GTGACTTGCTGAAGGTCACAGGG + Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059459210 9:114419186-114419208 GCAACTTGCCCAAGGTTGCATGG - Intronic
1059614157 9:115930792-115930814 GGGACTTGCTCTAGGTCACAGGG - Intergenic
1060672802 9:125485141-125485163 GACACTTGCTTAAGGTTACATGG + Intronic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061510549 9:131058443-131058465 TGGCCTTGCTCAAGGTCACATGG + Intronic
1062181088 9:135191688-135191710 GCAACTTTCTCAAGGTTGCACGG - Intergenic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1188028410 X:25235696-25235718 GTGACTTGCACAAGGTCACATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189589378 X:42495447-42495469 ACGACTTGCTTAAGGTTATACGG + Intergenic
1190533747 X:51406824-51406846 GCGCCTGGCTCTGGGTTGCACGG + Intergenic
1190902860 X:54695704-54695726 GTTCCTTGCTCAAGGTCCCAAGG + Intergenic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192862948 X:75097904-75097926 ACAACTTGCTTAAGGTTACAAGG + Intronic
1195412601 X:104584254-104584276 GGGACATGCTCAAGGTTACAGGG + Intronic
1197278401 X:124506657-124506679 GCTCCTTGCTCAGGGTAACAAGG + Intronic
1197752919 X:129977924-129977946 GTGGCTTGCTCAAGATTGCATGG - Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1199088037 X:143651694-143651716 GTGATTTGCTCAAGGTCACATGG + Intergenic
1199200288 X:145079527-145079549 GTGCTTTGTTCAAGGTCACATGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic