ID: 1080647009

View in Genome Browser
Species Human (GRCh38)
Location 11:34194694-34194716
Sequence ACAGCCCGACGGCGCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080647009_1080647013 -10 Left 1080647009 11:34194694-34194716 CCACCAGGGCGCCGTCGGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1080647013 11:34194707-34194729 GTCGGGCTGTTGGCTCCCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 119
1080647009_1080647014 0 Left 1080647009 11:34194694-34194716 CCACCAGGGCGCCGTCGGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1080647014 11:34194717-34194739 TGGCTCCCTCAGGTATTTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 157
1080647009_1080647015 1 Left 1080647009 11:34194694-34194716 CCACCAGGGCGCCGTCGGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1080647015 11:34194718-34194740 GGCTCCCTCAGGTATTTTTAGGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080647009 Original CRISPR ACAGCCCGACGGCGCCCTGG TGG (reversed) Intronic