ID: 1080650028

View in Genome Browser
Species Human (GRCh38)
Location 11:34214987-34215009
Sequence GATGATAGATACTTGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080650028_1080650031 -7 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650031 11:34215003-34215025 TATCATCTGGCCCCTTCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1080650028_1080650034 3 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650034 11:34215013-34215035 CCCCTTCGCCTGGCCCCAGGTGG 0: 1
1: 1
2: 2
3: 34
4: 341
1080650028_1080650037 6 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650037 11:34215016-34215038 CTTCGCCTGGCCCCAGGTGGTGG 0: 1
1: 0
2: 0
3: 18
4: 226
1080650028_1080650039 15 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290
1080650028_1080650032 0 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650032 11:34215010-34215032 TGGCCCCTTCGCCTGGCCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080650028 Original CRISPR GATGATAGATACTTGGAATG AGG (reversed) Intronic