ID: 1080650030

View in Genome Browser
Species Human (GRCh38)
Location 11:34214994-34215016
Sequence GGGGCCAGATGATAGATACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080650030_1080650032 -7 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650032 11:34215010-34215032 TGGCCCCTTCGCCTGGCCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 351
1080650030_1080650034 -4 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650034 11:34215013-34215035 CCCCTTCGCCTGGCCCCAGGTGG 0: 1
1: 1
2: 2
3: 34
4: 341
1080650030_1080650044 26 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650044 11:34215043-34215065 TCAGGCACTGCATCACCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 99
1080650030_1080650037 -1 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650037 11:34215016-34215038 CTTCGCCTGGCCCCAGGTGGTGG 0: 1
1: 0
2: 0
3: 18
4: 226
1080650030_1080650039 8 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290
1080650030_1080650043 25 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650043 11:34215042-34215064 CTCAGGCACTGCATCACCAGTGG 0: 1
1: 0
2: 1
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080650030 Original CRISPR GGGGCCAGATGATAGATACT TGG (reversed) Intronic