ID: 1080650039

View in Genome Browser
Species Human (GRCh38)
Location 11:34215025-34215047
Sequence GCCCCAGGTGGTGGTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080650030_1080650039 8 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290
1080650028_1080650039 15 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080650039 Original CRISPR GCCCCAGGTGGTGGTGACTC AGG Intronic