ID: 1080650039

View in Genome Browser
Species Human (GRCh38)
Location 11:34215025-34215047
Sequence GCCCCAGGTGGTGGTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080650028_1080650039 15 Left 1080650028 11:34214987-34215009 CCTCATTCCAAGTATCTATCATC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290
1080650030_1080650039 8 Left 1080650030 11:34214994-34215016 CCAAGTATCTATCATCTGGCCCC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 21
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080650039 Original CRISPR GCCCCAGGTGGTGGTGACTC AGG Intronic
900145324 1:1156741-1156763 GCCTCAGGTGGAGGTGGGTCCGG + Intergenic
900389371 1:2427381-2427403 GCCCCTGCTGGTGGTTTCTCCGG + Intronic
900582622 1:3416567-3416589 TCCCCAGGTGCTGGTGTCACTGG - Intronic
902760398 1:18577074-18577096 GCCCCAGGGGGTGGGGGTTCAGG - Intergenic
902768735 1:18633445-18633467 CCCCCGGGTGGGGGTGACTTTGG - Intronic
902925598 1:19693887-19693909 GCCCTGGGTGGGGGGGACTCGGG + Intronic
903017333 1:20369425-20369447 GCCCCTGGTGGGGGTGAGGCAGG - Intergenic
903569075 1:24291104-24291126 CCCACAGGTGGTGATGACACAGG + Intergenic
903893645 1:26587598-26587620 GACCCAGGTGATGGTTAGTCTGG + Intergenic
905007646 1:34723128-34723150 GCTCTAGATGATGGTGACTCAGG + Intronic
905815730 1:40949368-40949390 GCCCCTGGTGCTGGGGACACAGG - Intergenic
906151598 1:43591020-43591042 GTCCCAGGTGAGGGTGACACTGG - Exonic
906225174 1:44116171-44116193 GCCCCAGGAGGAGGTGATCCTGG + Intergenic
906801776 1:48744217-48744239 GCCCCAGGTGCTGGGGACAAAGG - Intronic
910371765 1:86523950-86523972 GCCCCATGGGGAGGTGGCTCAGG + Intergenic
912587274 1:110778483-110778505 GCCCCAGGAGGGACTGACTCAGG - Intergenic
913676888 1:121149344-121149366 GGCTCAGGAGGTGGTGACTGGGG + Intergenic
914028781 1:143937296-143937318 GGCTCAGGAGGTGGTGACTGGGG + Intergenic
914855288 1:151346247-151346269 CCCCCAGGTGGTGCTGAGGCTGG - Exonic
915362646 1:155295248-155295270 CTCCCAGGTGCTGGTGACTGTGG - Exonic
915603132 1:156935114-156935136 GCCCCAGGAGGTGGGGACAGGGG - Exonic
916058465 1:161083672-161083694 GCGCAAGGTGGTGGTGGCTGTGG - Intronic
916853805 1:168729121-168729143 GCCCCAGGCCATGGTGACTAGGG + Exonic
916936545 1:169633662-169633684 GCTCCTGGTGGTGGTGACACTGG - Intergenic
917840451 1:178973304-178973326 GCCCAGGGTGGAGGTCACTCAGG + Intergenic
919854191 1:201694460-201694482 GCCCCAGCAGCTGGTGACCCCGG - Intronic
920020686 1:202954143-202954165 GTCTCAGGTTTTGGTGACTCTGG - Intronic
920464245 1:206168186-206168208 GGCTCAGGAGGTGGTGACTGGGG + Intergenic
921047779 1:211489825-211489847 GGCCCAGGTGGTGAGGCCTCAGG + Intronic
921130358 1:212214547-212214569 GCCCCAGGTGGGGCTTCCTCGGG + Intergenic
922078990 1:222276242-222276264 GCCACGGGTGGTGGTGACAAAGG - Intergenic
922706431 1:227793128-227793150 GCCCCAGCTGGAGGCAACTCAGG + Intergenic
922958681 1:229626220-229626242 GTCCCACGTGGTGGGGACGCGGG + Exonic
1063346606 10:5317944-5317966 CCCCCAGGTGTTGGTTACACAGG + Intergenic
1063960604 10:11302413-11302435 GCCCCAGGTGGTGCCGATGCGGG + Intronic
1065888071 10:30096203-30096225 GCCCCAGGTGCTGGGGACAGAGG + Intronic
1067751839 10:48976861-48976883 GCCCCAGGCTGTGGTGATGCTGG - Exonic
1067795750 10:49320401-49320423 GGCCCAGGTGATGCAGACTCTGG + Intronic
1068363566 10:56012939-56012961 AGACCATGTGGTGGTGACTCTGG - Intergenic
1069544287 10:69318106-69318128 GCCACCGGAGCTGGTGACTCGGG + Intronic
1069832280 10:71288753-71288775 GGCCCTGGGGGTGGGGACTCTGG + Intronic
1070304752 10:75233755-75233777 GCCCGAGGTGCTGGGGTCTCTGG + Intergenic
1071297532 10:84232981-84233003 GCCCCAGGTGGTACACACTCAGG + Intronic
1073421249 10:103425364-103425386 TACCCATGTGGTTGTGACTCTGG + Exonic
1073444010 10:103570236-103570258 GCCTCAGGGGCTGGGGACTCTGG - Intronic
1074317462 10:112372390-112372412 ACCCCAGGTGGTTGCCACTCCGG - Intergenic
1074483593 10:113852035-113852057 GCCCCAGTTGGTGGTTATTATGG - Intronic
1076715535 10:132362077-132362099 GACCCAGGTGAAGGGGACTCAGG + Intronic
1076892865 10:133293370-133293392 GCCCCAGGAGGAGATGAGTCAGG + Intronic
1077472977 11:2772986-2773008 GCCACAGCTGGCTGTGACTCTGG + Intronic
1077502224 11:2914560-2914582 GCCCCAGGAGGTAGGGAGTCAGG - Intronic
1078012127 11:7580479-7580501 GTCCAAGGTGGTGGTGTCTCAGG + Intronic
1078335692 11:10461456-10461478 TTCCCCGGTGCTGGTGACTCAGG + Intronic
1079009944 11:16819635-16819657 TCCCCAGGTGGTGCTGATGCTGG - Intronic
1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG + Intronic
1081101376 11:39006799-39006821 GCTCCAGCAGGTGGTGACTCCGG + Intergenic
1081661031 11:44888564-44888586 GCCCCAGGGAAAGGTGACTCTGG - Intronic
1082160414 11:48883208-48883230 GCCCTAGGTACTGGTGACACAGG + Intergenic
1082161952 11:48897198-48897220 GCCCTAGGTACTGGTGACACAGG - Intergenic
1082167537 11:48965642-48965664 GCCCTAGGTAATGGTGACACAGG - Intergenic
1082236019 11:49821008-49821030 GCCCTAGGTACTGGTGACACAGG + Intergenic
1082239480 11:49855564-49855586 GCCCTAGGTACTGGTGACACAGG + Intergenic
1082242670 11:49888788-49888810 GCCCTAGGTACTGGTGACACAGG - Intergenic
1082609525 11:55280936-55280958 GCCGCAGGTACTGGTGACACAGG + Intergenic
1082657163 11:55869597-55869619 GCCCTAGGTACTGGTGACACAGG - Intergenic
1083384225 11:62295756-62295778 GCCTCAGGTGCTGGTGAGTGAGG + Intergenic
1083478195 11:62927190-62927212 GCCCCGGGCGGCGGTGACTGAGG - Intergenic
1085157660 11:74311337-74311359 GCCGCAGGGTGGGGTGACTCAGG - Intronic
1085295897 11:75431459-75431481 GACCCAGGTGGAGGGGAGTCAGG + Intergenic
1089256281 11:117195997-117196019 ACCCCAGGTGTTGCTGACACTGG + Exonic
1089288331 11:117421816-117421838 AACCCAAGTGGTGGTGTCTCAGG - Intergenic
1089511165 11:118998164-118998186 GCCGCTGGTGGTGGTGATACCGG + Exonic
1090592579 11:128288503-128288525 GCCACTGGTGGTGGTGGCCCCGG - Intergenic
1091399481 12:173576-173598 GCCCCAGGTGGTGCTGCCCGAGG + Intronic
1092140096 12:6177972-6177994 GCTCCAGGTGGCATTGACTCTGG - Intergenic
1092184139 12:6466286-6466308 GCCCCAGGTGGGGGTCCCCCTGG - Exonic
1093339207 12:17950317-17950339 GCCTTATGTAGTGGTGACTCTGG - Intergenic
1096115450 12:49052292-49052314 GCCTCAGGTGGTGGGGACGTGGG + Exonic
1096503069 12:52077138-52077160 GCGCATGGTGGTGGTGACTGAGG - Exonic
1097145345 12:56935978-56936000 GGCCCAGGAGGTGCTGAGTCAGG - Intergenic
1098693080 12:73514648-73514670 GCACCATGCAGTGGTGACTCTGG + Intergenic
1100072522 12:90737676-90737698 GCCCAAGGTGGTGATGGCGCAGG + Intergenic
1101806285 12:108067117-108067139 CCCCAGGGTGGTGGTTACTCAGG - Intergenic
1102038155 12:109783701-109783723 GGACGAGGTGGTGGTGCCTCTGG - Exonic
1104127518 12:125861804-125861826 GGCCGAGGTGGCGGTGACGCAGG + Intergenic
1104319040 12:127732881-127732903 GCCTGATGTGGTGGTGGCTCAGG - Intergenic
1106176996 13:27340204-27340226 ATCCTGGGTGGTGGTGACTCTGG + Intergenic
1106403013 13:29447729-29447751 TCCCCAGGTGGTGGTGGTTGTGG + Intronic
1106825975 13:33520800-33520822 GCCCCAGGTGGTGGGGGCATGGG - Intergenic
1107453924 13:40537062-40537084 GCCCCAGGTGTTTGTGAAGCAGG - Intergenic
1108555221 13:51584753-51584775 GTCCCAGGAGGTGGTGAATATGG + Exonic
1109676064 13:65676741-65676763 GTACCATGTAGTGGTGACTCTGG + Intergenic
1111865793 13:93766991-93767013 CCCCGCGGTGGTGGTGACTCTGG + Intronic
1112209436 13:97361206-97361228 GCACCAGGTGGTGGTTACGAAGG + Intronic
1114343731 14:21772949-21772971 CCTCCAGGTGGTGGTGACGGTGG - Intergenic
1118507866 14:66434410-66434432 GATCAAGGTGGTGGTGACTGTGG - Intergenic
1119195481 14:72714247-72714269 GCCCAAGGAAGTGGTGACTGCGG + Intronic
1121613827 14:95299485-95299507 GCACCAGGTGCTGGAGACACAGG + Intronic
1122468301 14:101949070-101949092 GCCCAAGGTACTGGTGACCCTGG + Intergenic
1122937451 14:104966687-104966709 GCCCCAGCTGGTGGTCCCTCAGG - Intronic
1124624219 15:31298989-31299011 GGCCCAGGTGGAGGTGTCTGGGG + Intergenic
1125486656 15:40115921-40115943 GCCACAGGTGGTGGTGGCAGTGG - Intergenic
1125514285 15:40309136-40309158 GCCCCATGGGGGGGTGACCCAGG - Intergenic
1131071815 15:89470952-89470974 GCCCAGGGTGGTGGTGAGCCTGG + Intergenic
1132465684 16:76457-76479 GCCCCAGGAGGTGGAGAGGCCGG - Intergenic
1132553648 16:563706-563728 GCCACAGGGGGTGGTGGCCCTGG - Exonic
1135906465 16:26516634-26516656 TGCCCAGTTTGTGGTGACTCTGG + Intergenic
1136112767 16:28075225-28075247 GCACTGGGTGGTTGTGACTCAGG + Intergenic
1136453939 16:30370069-30370091 GCCCGTCGTGGTGGTGGCTCCGG - Exonic
1136550434 16:30979800-30979822 CCCCGAGGTGGTGGTGGCTGAGG + Exonic
1137729819 16:50681123-50681145 GCCCCAGGAGAAGGGGACTCAGG + Intronic
1138010299 16:53373203-53373225 GCTCCAGCTGGGGGTGAGTCTGG - Intergenic
1138522247 16:57577712-57577734 GCCCCAGGGAGTGGGGACACAGG + Intronic
1139047202 16:63076249-63076271 ACCCCAGATGGTGGTGAAGCTGG + Intergenic
1140778423 16:78272174-78272196 GCCCCTTGTGGTGTTGACTGGGG + Intronic
1141161490 16:81632123-81632145 GATCCAGGTGGTGGTTACTCAGG - Intronic
1141528406 16:84628604-84628626 GCCCCAGGTCGTGGTGCCTGGGG - Intergenic
1141741250 16:85894498-85894520 GCCCCATCTGCAGGTGACTCTGG + Intergenic
1141906263 16:87028920-87028942 GCCACAGGTGGTGGTCAGTGGGG - Intergenic
1142025424 16:87810367-87810389 CCCACAGGTGCTGGTGACTCTGG + Intergenic
1142148006 16:88500452-88500474 GCCCACGCTGGTGGTGACACGGG - Intronic
1142987669 17:3706570-3706592 GCTCCAGGTGGTGGTGATGTGGG - Intergenic
1145910073 17:28537284-28537306 GCCCCGGGCAGTGGTGGCTCCGG + Exonic
1146625856 17:34434986-34435008 TTCCTAGGTGGTGGTGACACAGG - Intergenic
1146915317 17:36674569-36674591 GAGCCAGGTGGTCCTGACTCAGG - Intergenic
1147185588 17:38711558-38711580 GGCCCAGGTGGAGGTGAGACTGG - Intronic
1147604929 17:41769192-41769214 CCTCCAGGTGGTGGTGACCAAGG - Exonic
1147673922 17:42192334-42192356 GCTGCAGGTGGTGGTGACTCTGG - Exonic
1148767894 17:50049884-50049906 GCCCCAAGTGCTGGTGCCTGAGG + Intergenic
1149639074 17:58191573-58191595 GGCCACAGTGGTGGTGACTCTGG + Intergenic
1150145090 17:62762129-62762151 GCCCCAGGCTGTGGTGAATAGGG + Intronic
1150218252 17:63481968-63481990 GGCCCAAGTGGTGGTGAGCCAGG + Intergenic
1151835615 17:76581022-76581044 GCCACAGGTGGAGGGGACTCTGG + Intronic
1152248402 17:79198340-79198362 GCACCTGGCGATGGTGACTCAGG + Intronic
1152397770 17:80045093-80045115 TCCGCAGATGGTGTTGACTCTGG - Intronic
1152698928 17:81809844-81809866 GGCTCAGGTTGTGGTGACACTGG - Exonic
1152911993 17:83010229-83010251 GCCCCCGGTGCTGGTGACTCTGG - Intronic
1153808937 18:8734820-8734842 GACCCTGGGGGTGGTGACCCAGG + Intronic
1154359000 18:13643420-13643442 GCCCCAGGAGGTGATGGCTGCGG + Intronic
1156042355 18:32836825-32836847 GCCCCTGGTTGTGCTGACTTTGG + Intergenic
1157273626 18:46294832-46294854 GCCCTTGGTGGTGGGGACTGAGG + Intergenic
1160416803 18:78717494-78717516 GGCCCAGGAGGTGGAGACCCAGG - Intergenic
1160515431 18:79476854-79476876 GACTCACGTGGTCGTGACTCCGG + Intronic
1161778599 19:6277512-6277534 GCCACAGATGCTGGTGACTGTGG + Intronic
1162455433 19:10781264-10781286 CACACAGGTGATGGTGACTCTGG + Intronic
1164444502 19:28305707-28305729 GGCCCACGTTGTGGTGACTGCGG - Intergenic
1165289099 19:34868760-34868782 GCTCAAGGTGGTGGCAACTCAGG - Intergenic
1165601234 19:37057052-37057074 GCCTCAGGGAGTGGTTACTCAGG - Intronic
1167513126 19:49907305-49907327 GCCCAAGGTGGGGGTGAGCCTGG + Intronic
1167601812 19:50459122-50459144 GCCCCAGGTGGTGTGGACCAAGG + Exonic
1168403455 19:56098949-56098971 GCCCCAGGTGGTGGGTCCCCAGG - Intronic
1168464260 19:56589390-56589412 GCAGCAGGTGGTGGTGACTTGGG - Intergenic
1168471211 19:56642765-56642787 GCCCCAGGCGGTCGGGCCTCAGG + Intergenic
1168711054 19:58500174-58500196 GCCCCAGATGGTGGTAAGGCAGG + Intronic
925148508 2:1599144-1599166 GCCTCAGTAGGTGGTGAATCTGG + Intergenic
925744247 2:7031162-7031184 GGCCCAGGTGTTGGGGACCCTGG + Intronic
927481511 2:23457530-23457552 CCCCGAGGTGGGGGTGCCTCTGG + Intronic
927554289 2:24021586-24021608 ACCCCTGGAGGTGGTGACACCGG - Intronic
927639119 2:24835634-24835656 GCCCCAGGGAGTCGTGACTGTGG - Intronic
929024096 2:37582571-37582593 GCTTCAGTTGGTGCTGACTCAGG - Intergenic
929031000 2:37649719-37649741 GCCCCTGGTGCTGGTGCCTGTGG - Intronic
929665176 2:43828232-43828254 TCCCCAGGGTGTGGTGAGTCTGG - Intronic
929868469 2:45737765-45737787 GCCCCAGGTGGAGGTGAGGGAGG - Intronic
930050300 2:47210490-47210512 GCCCAGGGTGGTGGTGACTTTGG + Intergenic
931005979 2:57850371-57850393 TCCCCAGGTTGTGGAAACTCTGG + Intergenic
931236395 2:60416460-60416482 GCACAAGGAAGTGGTGACTCGGG + Intergenic
931967594 2:67550677-67550699 GCCCTAGGTCCTGCTGACTCTGG - Intergenic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
932727073 2:74188574-74188596 GGCCCAGGTGGGGATGACACTGG + Intergenic
933246240 2:79977994-79978016 GCAGCAGCGGGTGGTGACTCAGG + Intronic
934862940 2:97779580-97779602 GTCCCAGGTGATGCGGACTCTGG - Intronic
935275193 2:101470364-101470386 GCCCCAGGTGGTTGGAAGTCAGG - Intronic
936077911 2:109413599-109413621 GCCCCAGGTCCTGGTGATTTGGG - Intronic
938473648 2:131589114-131589136 GAGGCAGGTGGTGCTGACTCAGG + Intergenic
938540430 2:132280309-132280331 GCTGGTGGTGGTGGTGACTCTGG - Intergenic
940983166 2:160024977-160024999 GCACCAGGCAGTGGTGACTCCGG - Intronic
942519717 2:176790835-176790857 GCACCAGCTGGTGGTGCCTATGG + Intergenic
943475862 2:188354216-188354238 GCACCATGCAGTGGTGACTCTGG - Intronic
947171945 2:227320897-227320919 GCCCATGGTGGGGGTGGCTCGGG - Intergenic
948281072 2:236748389-236748411 GGCTCAGGAGGTGGTGTCTCAGG + Intergenic
948693588 2:239721696-239721718 GCCCAATGTGGGGGTGGCTCTGG - Intergenic
948803645 2:240443795-240443817 GCCCCTGGTGCTGCCGACTCTGG - Intronic
949069985 2:242018621-242018643 GCCCCAGGGGAGGGTGGCTCTGG + Intergenic
1169778604 20:9283885-9283907 GCCTTAAGTGTTGGTGACTCAGG - Intronic
1171823605 20:29876169-29876191 GCCCCAGGTGTTGGAAGCTCTGG + Intergenic
1171896483 20:30814176-30814198 GCCCCAGGTGTTGGAAGCTCTGG - Intergenic
1172097101 20:32465825-32465847 GCTCCCGGTGGAGGTGCCTCAGG + Intronic
1173384141 20:42572784-42572806 GCTCCAGGTGGTGTTTACACAGG - Intronic
1173405379 20:42759862-42759884 GCCCCAACAGGTGGTGTCTCTGG + Intronic
1175102003 20:56585918-56585940 GAGCCAGGTGTTGGTGGCTCAGG + Intergenic
1175457866 20:59128687-59128709 GTCAGAGGTGGTGGTGGCTCAGG + Intergenic
1175776753 20:61658654-61658676 GCCCCAGCTGGTGCTGAGACAGG - Intronic
1175861523 20:62152682-62152704 ACACCAGGTGGAGGAGACTCAGG + Intronic
1175923055 20:62458960-62458982 CCCCCAGGTGGGGGTGGCCCTGG - Intergenic
1176173410 20:63706658-63706680 GCCCACGGTGGTGGTGATTTTGG + Exonic
1176745579 21:10649477-10649499 GTCCCTGGTTATGGTGACTCTGG + Intergenic
1176945918 21:14981499-14981521 GACCCAGGTTGGGGAGACTCAGG + Intronic
1177401094 21:20606078-20606100 ACCTGGGGTGGTGGTGACTCTGG + Intergenic
1180005164 21:45017437-45017459 GCTCCAGGTGTGGGTGAGTCAGG + Intergenic
1180163824 21:46010100-46010122 GCTCCAGGTGGTGATGCCTCAGG + Intergenic
1180845548 22:18979302-18979324 TCCCCAGCTGGAGGTCACTCAGG - Intergenic
1181338015 22:22155624-22155646 TTCCCAGGTTGTGGTGACACAGG + Intergenic
1181365029 22:22369790-22369812 TTCCCAGGCTGTGGTGACTCAGG + Intergenic
1181765387 22:25087862-25087884 TCCCCAGGTGCTGGGGGCTCTGG - Intronic
1183427074 22:37745933-37745955 GCCCAGGGTGCAGGTGACTCCGG - Intronic
1183431599 22:37769197-37769219 GCCCCAGGTTGGGGGGACACGGG + Intronic
1184264329 22:43339012-43339034 GCCCCAGCTGGTGATGAATGGGG + Intronic
1184379151 22:44134273-44134295 GTGGCTGGTGGTGGTGACTCGGG + Intronic
1184784199 22:46663914-46663936 GCCCATGGCGGTGGGGACTCTGG + Intronic
1185345465 22:50308684-50308706 GCCCCAGGGAGGGGTGACCCAGG - Intergenic
952898783 3:38096219-38096241 GCCCTCGGTGGTGGTGAGTGTGG + Intronic
953803954 3:46052070-46052092 GTCCCAGGAGTTGTTGACTCTGG - Intergenic
954174255 3:48831071-48831093 GGCCCAGGGGGTGGGGACCCGGG + Intronic
954363438 3:50134290-50134312 TCCCCAGGTGGAGTGGACTCCGG - Intergenic
954756062 3:52840633-52840655 GGCCCTGCTGGGGGTGACTCAGG - Intronic
958534738 3:95385823-95385845 GCCCCAGGTACTTGTGAGTCTGG - Intergenic
959798083 3:110456909-110456931 GCCAGTGGTGGTGGTGACTATGG - Intergenic
959835748 3:110916714-110916736 GCCCCTGCTGGGGGTGCCTCGGG + Intergenic
961602460 3:128072276-128072298 GGCCCAGGTGGTGGGGACGGCGG - Intronic
961654888 3:128435710-128435732 GCCCCAGGTCATGCTGTCTCTGG - Intergenic
962433947 3:135347334-135347356 TCCCCAGGAGGATGTGACTCAGG - Intergenic
966910311 3:184555968-184555990 CCCCAAGGTGGTTCTGACTCTGG - Intronic
968360757 3:198145148-198145170 GCCACAGGAGGTGGTGAGTGGGG - Intergenic
968429100 4:544816-544838 GCCCGTGGTGGTGGTGGCTAAGG - Intergenic
968643279 4:1725762-1725784 GGCCCAGGTGGTGGTCACTGTGG + Intronic
968914615 4:3491997-3492019 GCCCCAGGAGGAGGGGACTCAGG + Intronic
968916676 4:3499766-3499788 GCAGCAGGTGGGGGTGACCCCGG + Intronic
969508895 4:7605906-7605928 CCCCCAGGTGGTGGTCTCTGTGG + Intronic
969990270 4:11254870-11254892 GCCCAGTGTGGTGGTGACTATGG - Intergenic
971048478 4:22832147-22832169 GTACCATGTAGTGGTGACTCTGG - Intergenic
972607320 4:40625588-40625610 ACCCCAGCTGGTGGATACTCAGG + Intronic
972778628 4:42266159-42266181 GCCCCACGTGGAGGTGGCTGAGG - Intergenic
973095670 4:46196267-46196289 GCCCAAGGAGGTGGAGCCTCAGG + Intergenic
973144804 4:46812483-46812505 GTACCATGAGGTGGTGACTCTGG + Intronic
975139197 4:70902669-70902691 GCCCCGCTTGGTGGTGACGCCGG - Intronic
981691674 4:147515596-147515618 TCCCCCTGTGGTGGAGACTCAGG + Intronic
985587457 5:748292-748314 GCCCCAGGTGTGGGGGGCTCAGG + Intronic
986733804 5:10653649-10653671 GCCCTAGGTACTGGTGACACAGG + Intergenic
992139110 5:73778135-73778157 GCACCAAGTGGTGGTTATTCTGG + Intronic
994217808 5:97158880-97158902 GCCTCGGGTGGTGGTGACCATGG - Intronic
996594528 5:125185593-125185615 GCCTGGGGTGGTGGTGACTATGG + Intergenic
999232245 5:150068555-150068577 GCCACAGGAGGCTGTGACTCTGG - Intronic
999435496 5:151560117-151560139 GACCTAGATTGTGGTGACTCAGG - Intronic
999750968 5:154627955-154627977 ACCCCACGTGATGCTGACTCGGG - Intergenic
1001024683 5:168214127-168214149 GACCCAGCTGGTGGTGACCTTGG - Intronic
1001414349 5:171534112-171534134 CTCCCAGGCGTTGGTGACTCAGG - Intergenic
1001697131 5:173679227-173679249 GTAACAGGTGATGGTGACTCTGG + Intergenic
1003527392 6:6909649-6909671 GTCCCAGGTGGTGCTGGCTCTGG + Intergenic
1005432619 6:25774524-25774546 GCCCCAGGAGGCAGTGGCTCTGG + Intronic
1006341357 6:33448836-33448858 GACACAGGGGGAGGTGACTCCGG + Intronic
1006378991 6:33687092-33687114 GCCCCAGGAGCTGGTGAGGCTGG + Exonic
1007655034 6:43446628-43446650 TGCCCAGGTGGTGGTGGCTTGGG + Intronic
1008119182 6:47591308-47591330 GGCCTATGTGGTGGTTACTCTGG + Intronic
1009960860 6:70518997-70519019 GCCCCAGATGGTGATTCCTCTGG + Intronic
1013992052 6:116265216-116265238 GCTGGAGGTGGTGTTGACTCAGG + Intronic
1015808242 6:137133728-137133750 GCATCAGGCAGTGGTGACTCTGG - Intergenic
1016329111 6:142937504-142937526 CCCCCAGGTGGTGGTGGAGCTGG + Intronic
1017950382 6:159130756-159130778 GTCCCAGGTGGTGCTGACCTGGG - Intergenic
1018656734 6:166044044-166044066 GCCCAAGGTGGTGGTGATCTAGG + Intergenic
1019261098 7:82436-82458 GCCCCAGGTCCGGGTGACTGGGG - Intergenic
1019716306 7:2541029-2541051 CCCCCAGGAGCTGGTGACGCAGG - Exonic
1020016114 7:4833129-4833151 GCCCCAGGTGGCTGGGACACAGG + Intronic
1022521798 7:31013244-31013266 GTCTCAGGTCTTGGTGACTCTGG - Intergenic
1025062624 7:55823625-55823647 GGCCCAGGTGGGGGTGTCACTGG + Intronic
1026362766 7:69617902-69617924 TCCCCAAATGGTGGTGATTCTGG - Intronic
1026953406 7:74362160-74362182 ACACCAGGCGGTGGGGACTCTGG + Intronic
1029675194 7:102063929-102063951 GCCCCAGGTGGTGGTGGGAGGGG + Intronic
1029699889 7:102239435-102239457 ACCCCGGGTGGTGCTGGCTCCGG + Exonic
1029708208 7:102286497-102286519 GCCCGCGGTGGTGGTGGCCCCGG - Intronic
1030197584 7:106867897-106867919 GTACCAGGTGGTGCAGACTCTGG + Exonic
1032388149 7:131538651-131538673 GCCCCAGGGAGTGGCGACGCAGG - Intronic
1032446882 7:131991892-131991914 ACCCCAGGTTGTTTTGACTCTGG + Intergenic
1032541899 7:132710133-132710155 CCCCCTGGTGGTGGTGATTCTGG - Intronic
1033328763 7:140400795-140400817 GCCCTGAGTGGTGGTGACACAGG - Intronic
1034139385 7:148802056-148802078 GGCGCAGGTGGTGGTGAGCCAGG + Intergenic
1043874071 8:85464566-85464588 GCCACAGGTGGTGCTGAAGCTGG - Intronic
1048355294 8:133648914-133648936 ACCCCAGGAGGTGGGGAGTCAGG - Intergenic
1049148304 8:141018193-141018215 GCCCCTGGTGGAGGTGGTTCTGG - Intergenic
1049368726 8:142253418-142253440 GCCACTGGGGGTGGTGACTCGGG - Intronic
1050271656 9:3952355-3952377 CCCCTGGGTGGTGGTGCCTCTGG - Intronic
1051257681 9:15231981-15232003 AGCCCTGGTGGGGGTGACTCGGG - Intronic
1051799113 9:20911321-20911343 GCCCCAGGGTATGGTGAGTCGGG + Intronic
1051910995 9:22154321-22154343 GCCCCTGGTTGTGGTGACACTGG - Intergenic
1053363832 9:37508846-37508868 GCCCCAGGAGGTAGAGATTCTGG + Intergenic
1053443192 9:38132340-38132362 GCCTCAGGTGGTGTTGGTTCAGG - Intergenic
1053749116 9:41235489-41235511 GCCCCAGGTGTTGGAAGCTCGGG - Intergenic
1054254555 9:62800342-62800364 GCCCCAGGTGTTGGAAGCTCGGG - Intergenic
1054336748 9:63815260-63815282 GCCCCAGGTGTTGGAAGCTCGGG + Intergenic
1055859390 9:80730290-80730312 GCACCACGTAGTGGTAACTCCGG + Intergenic
1056552615 9:87664127-87664149 GCCCCAGGTGGAGGTGAAAGTGG - Intronic
1057531589 9:95851900-95851922 GCTCCAGATGGTGGTTACACAGG + Intergenic
1059595048 9:115711191-115711213 TCCCCGGGTGCAGGTGACTCTGG + Intergenic
1060733650 9:126052803-126052825 GCCCCAGGTGGAGATGAGGCCGG + Intergenic
1060739816 9:126090898-126090920 CCCCCAGGTGATGGGGACTCTGG + Intergenic
1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG + Exonic
1061171812 9:128962012-128962034 GACCCAGGAGGTGGAGACTGTGG - Intronic
1061838274 9:133343165-133343187 GCCCCAGGTCATGCTGGCTCTGG + Intronic
1062444997 9:136589913-136589935 GCCCCAGATGGTGCCAACTCTGG - Intergenic
1062500755 9:136851061-136851083 GCCCCCGGAGGTGGTGACGCAGG - Intronic
1062545873 9:137063590-137063612 GCCCCTGGTTCTGGTGACACTGG + Exonic
1203376676 Un_KI270442v1:382685-382707 GCCCCAGGTGTTGGAAGCTCTGG + Intergenic
1185534324 X:848624-848646 GCCCCGGGTAGTGGTGGCTGGGG + Intergenic
1185582718 X:1223421-1223443 GCTCCATGTGGTGTTGACTGGGG + Intergenic
1187254479 X:17629797-17629819 GCTCCAGGGAGTGGGGACTCAGG + Intronic
1187326450 X:18295051-18295073 GCCCCTGGTGGTGGCGGCTGTGG - Intronic
1190560452 X:51681104-51681126 TCAGAAGGTGGTGGTGACTCTGG - Intergenic
1190563839 X:51712217-51712239 TCAGAAGGTGGTGGTGACTCTGG + Intergenic
1190915929 X:54811085-54811107 TCCCGAGGTGGTGGTGCTTCAGG - Exonic
1193555737 X:82951663-82951685 GCCCTTGGTGGTGGTGGCTATGG - Intergenic
1194285636 X:92007377-92007399 GCCTGAGGTGGTGGTGGCTATGG - Intronic
1194476551 X:94366165-94366187 GCCCAAGGTGGTCGAGACACAGG - Intergenic
1194920832 X:99761666-99761688 GCCTGAGGTGGTGGTGGCTATGG + Intergenic
1197623748 X:128780750-128780772 GCCCCAGGGGGAGGGGACTGGGG - Intergenic
1199642071 X:149872086-149872108 ACTGGAGGTGGTGGTGACTCAGG - Intergenic
1200603201 Y:5231916-5231938 GCCTGAGGTGGTGGTGGCTATGG - Intronic