ID: 1080653076

View in Genome Browser
Species Human (GRCh38)
Location 11:34237971-34237993
Sequence ATCACACATCAGGGCAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080653076 Original CRISPR ATCACACATCAGGGCAAATG GGG (reversed) Intronic
901494565 1:9613719-9613741 GTCACAAAGCAGGGCACATGGGG - Exonic
901958123 1:12802109-12802131 ATCACACATCAGGGCCTCTCAGG - Intergenic
903352187 1:22724182-22724204 AACACACAGGAGAGCAAATGTGG - Intronic
904986762 1:34557182-34557204 ATCACACACCAGGGCCTATCAGG + Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
906178104 1:43793313-43793335 TAATCACATCAGGGCAAATGGGG + Intronic
906572922 1:46860050-46860072 ATCACACATCTGTGAAAATTTGG + Intergenic
906598842 1:47105840-47105862 ATCACACATCTGTGAAAATTTGG - Intronic
906889128 1:49688008-49688030 TAATCACATCAGGGCAAATGGGG + Intronic
907614447 1:55910076-55910098 TAAACACATCAGGGTAAATGGGG - Intergenic
907822003 1:57979393-57979415 ATCACAGACCAGGGCCTATGGGG + Intronic
908016058 1:59837856-59837878 ATCACACACCAGGGCCTGTGGGG - Intronic
908519816 1:64930977-64930999 ATCACACACCAGGGCCAGTCAGG + Intronic
909440172 1:75688070-75688092 GTCACTCATCAGGGCAAACAAGG - Intergenic
910060321 1:83084011-83084033 ATCACATATCAAGGCTAAAGGGG - Intergenic
910331520 1:86077817-86077839 ATCACACACCAGGGCCTGTGGGG + Intronic
910925520 1:92394305-92394327 ATCACACACCAGGGCCTGTGGGG + Exonic
911275741 1:95855060-95855082 ATCACAGCTAAAGGCAAATGAGG + Intergenic
911550186 1:99269087-99269109 ATCACACACCAGGGCCTGTGGGG - Intronic
911595548 1:99794760-99794782 ATCACACACCAGGGCCTGTGGGG - Intergenic
911667413 1:100569184-100569206 ATCACACACCAGGGCCTATCAGG + Intergenic
911808472 1:102242630-102242652 ATCACACACCAGGGCCTATCGGG - Intergenic
912872240 1:113319003-113319025 ATCACACACCAGGGCCTATTGGG + Intergenic
912882765 1:113434061-113434083 ATCACAAATCAGGGCAATGAAGG - Intronic
912948373 1:114103731-114103753 AGCACACAAGAGGGCAGATGAGG + Intronic
913506389 1:119519875-119519897 ATCACACACCAGGGCCTATCGGG - Intergenic
915011300 1:152688610-152688632 ATCACACATCGGGGCATATTGGG - Intergenic
915853136 1:159349720-159349742 ATCACACACCAGGGCCTATCAGG + Intergenic
916816482 1:168358574-168358596 ATCACACATCAGGGCCTGTTGGG - Intergenic
916973998 1:170054788-170054810 ATCACACATCAGGGCCTGTCAGG + Intronic
917527713 1:175803684-175803706 CTCAAACATCAGTGCAGATGTGG - Intergenic
917887901 1:179405084-179405106 ATCACACATCAGGCCTGTTGGGG - Intronic
917997429 1:180455350-180455372 ATCACACACCAGGGCCTATCGGG + Intronic
918665299 1:187143374-187143396 ATCACACACCAGGGCCTGTGGGG + Intergenic
918887892 1:190220371-190220393 ATCACACATCAGGGCCTGTCAGG + Intronic
919115620 1:193277050-193277072 ATCTCACATCAGGGAAATTGAGG + Intergenic
919151765 1:193710147-193710169 ATCACACAGCTGGGCAGAGGTGG + Intergenic
919358843 1:196563892-196563914 ATCACACATCATGCTCAATGAGG + Intronic
919941508 1:202289909-202289931 ATCACAGATAAGGGTACATGAGG - Intronic
921702288 1:218282300-218282322 AACACACACCAGGGCCAATCGGG + Intergenic
923890224 1:238206894-238206916 ATCACACACCAGGGCCTATCGGG + Intergenic
924955140 1:248919028-248919050 AAATCACATCAGGGTAAATGGGG + Intronic
1063729958 10:8685272-8685294 ATCACACACCAGGGCATGTCAGG + Intergenic
1064259401 10:13773001-13773023 TAACCACATCAGGGCAAATGGGG - Intronic
1064356219 10:14620693-14620715 ATCACACACCAGGGCCTGTGGGG - Intronic
1064363014 10:14682720-14682742 ATCACACAGCAGGGCATGTCAGG + Intronic
1064448712 10:15421899-15421921 ATCACACACCAGGGCATGTTGGG - Intergenic
1064797752 10:19032695-19032717 ATCACACATCAGGGCCTGTTGGG - Intergenic
1065496819 10:26337734-26337756 ATCTCACACCAGGGGAATTGAGG + Intergenic
1065668244 10:28086118-28086140 ATCACACATCAGGGCCTGCGGGG + Intronic
1066991121 10:42515003-42515025 TGAACACATCAGGGTAAATGGGG + Intergenic
1068372239 10:56131926-56131948 AACACACACCAGGGCCAATCAGG + Intergenic
1068427699 10:56888999-56889021 ATCACACATCAGGGCCTGTTGGG - Intergenic
1068457683 10:57279711-57279733 ATCACACACCAGGGCCTATCGGG - Intergenic
1071059893 10:81557350-81557372 ATCACACATCAGGGCCTGTCAGG - Intergenic
1071484397 10:86089107-86089129 ATGACCCAGCTGGGCAAATGGGG - Intronic
1072367342 10:94726360-94726382 ATCACACACCAGGGCCTGTGGGG - Intronic
1072912081 10:99511384-99511406 ATCTCACATCAGGGTAAATGGGG - Intergenic
1074100755 10:110353380-110353402 ATCACACATCAGGGTGTCTGGGG - Intergenic
1074719210 10:116250134-116250156 ATGACCCATCATGGGAAATGGGG + Intronic
1075283641 10:121163666-121163688 ATCACAGATCAAGGAAGATGAGG + Intergenic
1077600405 11:3570774-3570796 ATCACACACCAGGGCCCATCGGG + Intergenic
1078031221 11:7753388-7753410 ATCACACATCAGGGCCTGTCGGG + Intergenic
1078296739 11:10078608-10078630 ATCACACATCAGGGCCTATCGGG + Intronic
1079510024 11:21199808-21199830 ATCACACAACAGGGCCTATTGGG - Intronic
1080153951 11:29085947-29085969 GTGATACAACAGGGCAAATGGGG + Intergenic
1080155993 11:29111602-29111624 ATCACACACCAGGGCCTATCGGG - Intergenic
1080180076 11:29415476-29415498 ATCACACACCAGGGCCTGTGGGG - Intergenic
1080653076 11:34237971-34237993 ATCACACATCAGGGCAAATGGGG - Intronic
1080989953 11:37519819-37519841 ATCACACATCATGACAAAGTTGG + Intergenic
1081079681 11:38726233-38726255 ATCACACACCAGGGCCTATCGGG - Intergenic
1081487424 11:43542461-43542483 ATCACAGATCAAGGTAATTGGGG + Intergenic
1081715832 11:45249728-45249750 ATCACACACCAGGGCATGTCAGG + Intronic
1082171145 11:49007225-49007247 ATCACACACCAGGGCCTATCTGG - Intergenic
1082610953 11:55296960-55296982 ATAACACATAACGGGAAATGTGG - Intergenic
1082718971 11:56649882-56649904 ATCACACACCAGGGCCCATTGGG + Intergenic
1083434665 11:62634182-62634204 ATCACACAGCAGGGGAAAGTGGG + Intronic
1084256318 11:67945389-67945411 ATCACACACCAGGGCCCATCGGG + Intergenic
1086233088 11:84593626-84593648 ATCACACATCAGGGCCTGTCAGG + Intronic
1086505595 11:87500577-87500599 AGCACACACCAGGGCCAGTGAGG + Intergenic
1086531755 11:87794645-87794667 ATCACACACTGGGGCAGATGTGG - Intergenic
1086694757 11:89829864-89829886 ATCACACACCAGGGCCTATCTGG + Intergenic
1086711391 11:90014633-90014655 ATCACACACCAGGGCCTATCTGG - Intergenic
1087435521 11:98112504-98112526 ATCACACACCAGGGCCAGTCAGG + Intergenic
1087479698 11:98683964-98683986 TAATCACATCAGGGCAAATGGGG + Intergenic
1087529416 11:99359952-99359974 TAATCACATCAGGGCAAATGAGG - Intronic
1087560533 11:99784311-99784333 ATCACACACCTGGGCCTATGTGG - Intronic
1087930751 11:103974640-103974662 ATCACACACCAGGGCCTGTGAGG - Intronic
1088457815 11:110050555-110050577 ACCACGCATCAGGGCCACTGAGG - Intergenic
1089186517 11:116619247-116619269 ATCACACACCAGGGCCTGTGGGG - Intergenic
1090752184 11:129756749-129756771 ATCACACATCAGGGCCTGTCAGG + Intergenic
1091089476 11:132756942-132756964 ATCACACATCAGGGCCTGTCAGG - Intronic
1091698866 12:2646686-2646708 ATCACACACCAGAGCAAAAGGGG + Intronic
1091834402 12:3575562-3575584 ATCACACATCAGGGAAACAGGGG - Intronic
1092246228 12:6865970-6865992 ATCACCCATCTGGGGAAGTGGGG - Exonic
1092702753 12:11250845-11250867 ATCACACACCAGGGCCTATCAGG - Intergenic
1092739940 12:11618485-11618507 ATCACACACCAGGGCCTGTGAGG + Intergenic
1093184284 12:16002145-16002167 ATCACACACCAGGGCTGTTGTGG - Intronic
1094060529 12:26310527-26310549 ATCACACACCAGGGCCTATCGGG - Intergenic
1094468445 12:30779605-30779627 ATCAGACAGCAGGGAGAATGGGG + Intergenic
1095632341 12:44392937-44392959 AACAAACATCAGGGCAAATTTGG + Intergenic
1097141466 12:56905726-56905748 AACACACACCAGGGCCAGTGGGG + Intergenic
1097488976 12:60240582-60240604 ATCACACATCTGGGCCTGTGAGG + Intergenic
1098049660 12:66440251-66440273 TAACCACATCAGGGCAAATGGGG + Intronic
1098369691 12:69744147-69744169 ATCACACACCAGGGCCTGTGGGG - Intronic
1098654883 12:73015211-73015233 ATCACACATCGGGGCCTATTGGG - Intergenic
1098738226 12:74135292-74135314 ATCTCACATTAAAGCAAATGAGG - Intergenic
1099377397 12:81908539-81908561 ATCACACACCAGGGCCTATCAGG - Intergenic
1100651846 12:96599170-96599192 ATCACACATCAGGGCTTATTGGG - Intronic
1100916549 12:99429991-99430013 ATAACACACCAGTGCTAATGAGG + Intronic
1101067788 12:101040765-101040787 ATCACACACCAGGGCCTATGGGG - Intronic
1101085070 12:101227336-101227358 ATGATACATCAGGGAAAAAGAGG - Intergenic
1101365863 12:104069861-104069883 ATCACACACCAGGGCATATCGGG - Intronic
1102253355 12:111402475-111402497 TTATCACATCAGGGTAAATGAGG + Intergenic
1102979673 12:117231473-117231495 TAATCACATCAGGGCAAATGGGG - Intronic
1105043706 12:132984328-132984350 AAATCACATCAGGGAAAATGGGG + Intergenic
1107050451 13:36042140-36042162 ATCACACATGAGGGAATATTTGG + Intronic
1107472882 13:40706902-40706924 ATCACACACCAGGGCCTGTGGGG - Intergenic
1108918070 13:55641016-55641038 ATGACACTTAAGGGAAAATGTGG + Intergenic
1108996519 13:56740490-56740512 AACTCACATCAAGTCAAATGAGG - Intergenic
1109432100 13:62249586-62249608 ATCACACATCAGGGCCTGTCGGG + Intergenic
1109714583 13:66204731-66204753 ATCACACATCAGGGCCTGTCAGG + Intergenic
1110472086 13:75871681-75871703 ATGTCAAATCAGGGCAATTGGGG + Intronic
1110499249 13:76207486-76207508 ATCACACACCAGGGCCTGTGGGG - Intergenic
1110558810 13:76887854-76887876 ACCACACATCAGGATAAATCAGG + Intergenic
1110872419 13:80467989-80468011 ATCACACACCAGGGCATGTCAGG + Intergenic
1111303218 13:86372133-86372155 ATCACACACCAGGGCTTATTAGG - Intergenic
1111590486 13:90341367-90341389 ATCACACATCAGGGCTTGTTGGG - Intergenic
1111704513 13:91731693-91731715 ATCACACAGCAGGGCCAGTCGGG - Intronic
1111855102 13:93627165-93627187 ATCACACACCAGGGCCTATTGGG - Intronic
1112064839 13:95781966-95781988 ATCACACACCAGGGCCCGTGGGG - Intronic
1112718880 13:102219019-102219041 ATATCACATCAGGGAAAATGGGG + Intronic
1113143405 13:107179564-107179586 TAAACACATCAGGGTAAATGGGG - Intronic
1113931589 13:113971695-113971717 CTCACACATCCGGGCACCTGTGG + Intergenic
1114225346 14:20732831-20732853 AACACTCCTCATGGCAAATGAGG + Intronic
1114713500 14:24802086-24802108 ATAACACAGCAGGGCAAAGAAGG + Intergenic
1114827060 14:26093875-26093897 ATCACACATGTGGCCATATGAGG + Intergenic
1115402626 14:32979654-32979676 ATCCCTCAACAGGGCAAATAAGG - Intronic
1116202272 14:41813356-41813378 ATCACACACCAGGGCCACAGGGG - Intronic
1116668394 14:47808791-47808813 ATTTCACATCAGGGTAAATGGGG + Intergenic
1117213171 14:53522749-53522771 ATCACACACCAGGGCCTATCAGG + Intergenic
1117747839 14:58889484-58889506 ATCACACACCAGGGCCTATCAGG + Intergenic
1117794784 14:59381292-59381314 TAAACACATCAGGGTAAATGAGG + Intergenic
1118425627 14:65657852-65657874 AAATCACATCAGGGTAAATGGGG - Intronic
1120283671 14:82470226-82470248 ATCACACACCAGGGCCTATTGGG - Intergenic
1123706209 15:22953000-22953022 ATCACACACCAAGGCGGATGTGG - Intronic
1125351634 15:38773768-38773790 ATCACACACCAGGGCTAGTTGGG - Intergenic
1126565333 15:50090876-50090898 ATCACATTTCAGGCCAAGTGAGG - Intronic
1127219473 15:56862830-56862852 ATTACACATCATGGAAAATGGGG - Intronic
1128433848 15:67626227-67626249 ATCACATTTCAGGCCAAGTGTGG + Intronic
1129174832 15:73832494-73832516 ATCACACTTCATGGCACTTGTGG - Intergenic
1131672500 15:94634218-94634240 ATTACACAGAAGGGCAGATGTGG + Intergenic
1133185406 16:4093248-4093270 ATCTAACAACATGGCAAATGAGG + Intronic
1134569719 16:15280845-15280867 ATAAGGCATCAGGGCAATTGAGG - Intergenic
1134732661 16:16475204-16475226 ATAAGGCATCAGGGCAATTGAGG + Intergenic
1134934779 16:18236764-18236786 ATAAGGCATCAGGGCAATTGAGG - Intergenic
1134937170 16:18255904-18255926 TTATCACATCAGGCCAAATGGGG - Intergenic
1136465500 16:30440733-30440755 ATCACACACCAGGGCCCATTGGG - Intergenic
1137749555 16:50849420-50849442 AACACACAGCAGGACAGATGTGG - Intergenic
1138626223 16:58254114-58254136 ACGACACACAAGGGCAAATGCGG + Exonic
1139696269 16:68677445-68677467 ATCAAAAATCAGGCCGAATGCGG + Intronic
1141011164 16:80401007-80401029 ATATCACATCAGGGTAAATGGGG - Intergenic
1141052756 16:80786899-80786921 ATCACACACCAGGGCCTGTGGGG + Intronic
1141338378 16:83179085-83179107 GTCTCACATCAGAGCAAATGTGG + Intronic
1143367350 17:6416640-6416662 CACACACATCATGGCAACTGCGG + Intronic
1144397332 17:14857347-14857369 ATCACACACCAGGGCCAGTCAGG - Intergenic
1144700532 17:17335537-17335559 CAAACACATCAGGGCAGATGGGG + Intronic
1145279372 17:21456802-21456824 ATCACACACCAGGGCCAGTAGGG + Intergenic
1145855778 17:28155759-28155781 ATCACACATCAGGGCCTGTCGGG + Intronic
1146942421 17:36852823-36852845 ATCACACATCAGGGTATGTTAGG + Intergenic
1147057110 17:37843366-37843388 ATCACATTTCAGGGGAAGTGGGG + Intergenic
1147475368 17:40706664-40706686 ATATCCCATCAGGGTAAATGGGG + Intergenic
1147660871 17:42116294-42116316 CCCACACGTCAGGGCCAATGAGG + Intronic
1149039131 17:52166698-52166720 AACTCACATCAGAGTAAATGGGG - Intergenic
1149315905 17:55438513-55438535 ATCACACATCAGGGCCTGTCGGG + Intergenic
1151116157 17:71737769-71737791 ATCTCACATCAGTGGAAATCAGG - Intergenic
1151148783 17:72065797-72065819 ATCACAGCAGAGGGCAAATGAGG + Intergenic
1151229982 17:72677564-72677586 TTTTAACATCAGGGCAAATGAGG + Intronic
1151576545 17:74955252-74955274 ATCACATTTCAGGCCAGATGTGG + Intronic
1153072628 18:1123445-1123467 ATCACACACCAGGGCATGTCGGG - Intergenic
1153776264 18:8456712-8456734 ATCACACACCAGGGCCTATTGGG - Intergenic
1153895511 18:9555571-9555593 GTGCCACATCAGGGCTAATGTGG - Intronic
1154053780 18:10991392-10991414 ATCACACATCAGGGCCTGTCGGG - Intronic
1154381704 18:13857447-13857469 ATCACACATCAGGGCCTGTTGGG - Intergenic
1155324462 18:24651927-24651949 ATCACAAAGCAGAGCAAAGGAGG + Intergenic
1155562053 18:27089298-27089320 ATCACACACCAGGGCATGTCGGG - Intronic
1155693474 18:28654880-28654902 ATCACACACCAGGGCTTGTGGGG + Intergenic
1156627550 18:38927286-38927308 ATTACACATCAAGGCAGATTGGG + Intergenic
1156725541 18:40121865-40121887 ATCTGTCATCAGGGCAAATTGGG + Intergenic
1156819479 18:41355369-41355391 ATCACAGATCAGGGAAGATATGG - Intergenic
1157026409 18:43849501-43849523 ATCACACATCAGGGCCTGTAGGG - Intergenic
1157216949 18:45792178-45792200 ATCACACACCAGGGCTTGTGGGG + Intergenic
1157780765 18:50437089-50437111 ATCACACACCAGGGCCTGTGAGG + Intergenic
1158145140 18:54303923-54303945 ATCACACACCAGGGCCATTGTGG - Intronic
1159222286 18:65480654-65480676 ATCACACACCAGGGCCTTTGTGG - Intergenic
1159649282 18:70958243-70958265 ATCACACATCAGGGCCTGTAGGG - Intergenic
1159842828 18:73419445-73419467 AAATCACATCAGGGTAAATGGGG - Intergenic
1163650921 19:18517200-18517222 ATCACTCATCAGAGCAAACCGGG + Intronic
1163997081 19:21060710-21060732 TAATCACATCAGGGCAAATGGGG + Intergenic
1167711701 19:51115690-51115712 ATCACACATCAGGGTAGTTGAGG - Intergenic
925005838 2:442512-442534 ATCTCACAGCACAGCAAATGCGG - Intergenic
925212945 2:2066395-2066417 ATCACACAGCAGGGAAGAGGCGG - Intronic
925461629 2:4068095-4068117 ATCACACACCAGGGCCTATCAGG - Intergenic
926330050 2:11816928-11816950 ATCACACACCAGGGCCAGTCAGG - Intronic
926366113 2:12134262-12134284 ATCACACACCAGGGCCTATGGGG - Intergenic
926516195 2:13850182-13850204 ATCACACATCAGGGCCTGTTTGG + Intergenic
926686195 2:15699578-15699600 ATCACACACCAGGACCAATGAGG - Intronic
926821774 2:16859353-16859375 ATCACACACCAGGGCCTATGAGG - Intergenic
927328563 2:21835217-21835239 ATAATACATCAGGGTAAATGGGG - Intergenic
927997484 2:27496107-27496129 ATCACACAGCTGGACAAATTGGG - Intergenic
928008196 2:27582484-27582506 ATCCCAAAGCAGGGCAAGTGTGG + Exonic
929262306 2:39879371-39879393 AACACACATCAGGGCCCATTGGG + Intergenic
929280683 2:40074815-40074837 ATCACACACCAGGGCCTATGGGG - Intergenic
929799472 2:45087169-45087191 ATCACACACCAGGGCCAGTTGGG + Intergenic
932227663 2:70055607-70055629 AACACACATCAGGGCTGTTGGGG + Intergenic
933603693 2:84359795-84359817 ATCACACATCAGGGCCTATTGGG + Intergenic
934125904 2:88889776-88889798 ATCACACATCAGGGCCTGCGGGG - Intergenic
934708069 2:96498461-96498483 AACACAGGTCAGGGCACATGGGG + Intronic
935355457 2:102195085-102195107 ACCACACAACGGGCCAAATGTGG - Intronic
936580757 2:113698590-113698612 ATCACACACCAGGGCCTATTGGG + Intergenic
936639899 2:114300361-114300383 ATCACACACCAGGGCTTATTGGG - Intergenic
937492032 2:122379834-122379856 ATCACACATCAGGGCTTGTCAGG - Intergenic
937605653 2:123798755-123798777 ATCACACATCAGGGCCTGTCGGG - Intergenic
938998362 2:136704616-136704638 ATCACACATCAGGGCTTTCGGGG + Intergenic
939457422 2:142455287-142455309 ATCACACACCAGGGCATGTTGGG + Intergenic
940521523 2:154756532-154756554 ATCACACATCAGGGCCTGTCAGG - Intronic
940527726 2:154839108-154839130 ATCACACACCAGGGCCTATCGGG - Intronic
940699982 2:157028591-157028613 ATCACACATCAGGGCCTGTCAGG + Intergenic
941522339 2:166561521-166561543 ATCATACATTAGTGTAAATGAGG + Intergenic
941522689 2:166567226-166567248 ATCCCATATCATGGCAATTGAGG - Intergenic
943373543 2:187046862-187046884 TAATCACATCAGGGCAAATGGGG + Intergenic
943993990 2:194735572-194735594 ATCACACACCAGGGCAGTCGGGG + Intergenic
944327662 2:198425791-198425813 ATCACACACCAGGGCCTGTGAGG - Intronic
944378515 2:199077520-199077542 ATCACACATCAGGGCCTGTCGGG + Intergenic
945161179 2:206892636-206892658 AAGTCACATCAGGGTAAATGAGG + Intergenic
945647639 2:212519518-212519540 ATCACACACCAGGGCATATCAGG + Intronic
945686997 2:212983739-212983761 ATAAAAAATCAGGGCAATTGGGG - Intergenic
946503168 2:220271384-220271406 ATCAGAAATCAGGGCAATTCTGG - Intergenic
946597978 2:221327500-221327522 ATCACACATCAGGGCCTGTCAGG + Intergenic
946881165 2:224178575-224178597 ATCACAAACCAGGGCAAAGTAGG - Intergenic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1169753854 20:9023138-9023160 AACACAAATCAGGCCAAGTGTGG + Intergenic
1170021548 20:11841789-11841811 ATCACACACCAGGGCATGTCAGG - Intergenic
1170059091 20:12240736-12240758 ATCACACACCAGGGCCTATCGGG + Intergenic
1170120904 20:12910629-12910651 AGCACACATCAGAGGAAGTGTGG - Intergenic
1170901845 20:20471153-20471175 GTGACACATCAGGACTAATGTGG - Intronic
1171242535 20:23583166-23583188 ATCACACACCAGGGCCAGTCAGG - Intergenic
1172642307 20:36447874-36447896 ATCACACACCAGGGCCTATCAGG + Intronic
1173243034 20:41314936-41314958 CTCACACTTCAGGGTTAATGAGG + Intronic
1173556868 20:43972659-43972681 ATCACACTTCAGGGCAAAGAGGG + Intronic
1174297202 20:49556885-49556907 ATTTCACATCAGGAAAAATGAGG - Intronic
1175143601 20:56879364-56879386 ATCACACACCAGGGCCTATCAGG + Intergenic
1175714544 20:61246803-61246825 ATCAGCCATCAGGGCATCTGGGG + Intergenic
1175768306 20:61606393-61606415 GTCACACAGCAGGTCAAGTGGGG + Intronic
1176344054 21:5724804-5724826 ATCACACATCAGGGCTTGTCAGG - Intergenic
1176349752 21:5783108-5783130 ATGAAACAGGAGGGCAAATGAGG - Intergenic
1176356566 21:5903692-5903714 ATGAAACAGGAGGGCAAATGAGG - Intergenic
1176500773 21:7599652-7599674 ATCACACATCAGGGCTTGTCAGG + Intergenic
1176538375 21:8122873-8122895 ATCACACATCAGGGCTTGTCAGG - Intergenic
1176544073 21:8181178-8181200 ATGAAACAGGAGGGCAAATGAGG - Intergenic
1176563024 21:8364223-8364245 ATGAAACAGGAGGGCAAATGAGG - Intergenic
1176710692 21:10146988-10147010 TAAACACATCAGGGTAAATGGGG - Intergenic
1176899883 21:14427359-14427381 TAAACACATCATGGCAAATGGGG - Intergenic
1177086577 21:16712400-16712422 ATCACACACCAGGGCCTGTGAGG - Intergenic
1177137863 21:17325873-17325895 TTATCACATCAGGGTAAATGTGG - Intergenic
1177591176 21:23169734-23169756 ATCACACATCAGGGCCTGTTGGG + Intergenic
1177853216 21:26373423-26373445 ATCACACACCAGGGCCTGTGGGG - Intergenic
1178160243 21:29904103-29904125 ATCACACACCAGGGCCTGTGGGG + Intronic
1178787760 21:35669511-35669533 TTAACACATCATGGAAAATGGGG + Intronic
1178864110 21:36313484-36313506 ATCACACACCAGGGCCTATCGGG - Intergenic
1179050524 21:37885203-37885225 ATCACATAGCAGGGCTCATGGGG + Intronic
1180582144 22:16848176-16848198 ATCACACACCAGGGCCCATTAGG + Intergenic
1181040379 22:20189527-20189549 GTGTCACATCAGGGGAAATGGGG - Intergenic
1183022330 22:35037372-35037394 GTCACACAGCAGGGCAAAGGAGG + Intergenic
1184902056 22:47452474-47452496 ATTGTACATCAGGGCAAATACGG + Intergenic
1203248941 22_KI270733v1_random:97401-97423 ATGAAACAGGAGGGCAAATGAGG - Intergenic
949183804 3:1166863-1166885 ATCACACACCAGGGCCTATTGGG + Intronic
950050805 3:9987385-9987407 ATCCCATCTCAGGGCAGATGAGG - Intronic
950056194 3:10026593-10026615 ATCCCATCTCAGGGCAGATGAGG - Intronic
951494543 3:23311809-23311831 CTTACACATCAAGGTAAATGTGG + Intronic
951794839 3:26526978-26527000 ATCACACACCAGGGCCTATCAGG - Intergenic
952588656 3:34924112-34924134 ATCACACACCAGGGCATATCAGG - Intergenic
953356320 3:42259181-42259203 ATCACACACCAGGGCCTATCGGG + Intronic
953363597 3:42322607-42322629 ATCAGGCATCAGTGCAGATGTGG + Intergenic
953523430 3:43665353-43665375 ATCACACACCAGGGCCTGTGGGG + Intronic
955448360 3:59038105-59038127 ATCACACACCAGGGCCTATCAGG + Intronic
956161431 3:66357471-66357493 AGCAAACATCAGGGAAAATGTGG + Intronic
956318133 3:67962399-67962421 AAATTACATCAGGGCAAATGGGG - Intergenic
956400181 3:68870746-68870768 ATCACACATCAGGGCCTGTCGGG - Intronic
956535435 3:70270863-70270885 ATCACACACCAGGGCTTATCAGG + Intergenic
957071227 3:75569426-75569448 ATCACACACCAGGGCCCATCGGG + Intergenic
957545570 3:81631970-81631992 ATCACACACCAGGGCCTATTGGG - Intronic
957787206 3:84898677-84898699 ATCACACACCAGGGCCAGTCAGG - Intergenic
957917349 3:86703453-86703475 ATCACACATCAGGGCCTGTCAGG - Intergenic
958433769 3:94072965-94072987 ATCACACATCAGGGCCTGTCGGG - Intronic
958694033 3:97505350-97505372 ATCACACATCAGGGCCTGTCGGG - Intronic
959271645 3:104219257-104219279 ATCACACATCAGGGCCTGTTGGG - Intergenic
961082393 3:124037537-124037559 ATGACACATCATGAAAAATGTGG + Intergenic
961210745 3:125123552-125123574 ATCACAAATCATGGCAGAAGGGG + Intronic
961366712 3:126404660-126404682 TTCACAGAGCAGGGAAAATGAGG + Intronic
961452940 3:127010613-127010635 AGCACGCATCAAGGCCAATGTGG - Intronic
961490163 3:127251478-127251500 TTCTTAGATCAGGGCAAATGAGG - Intergenic
961583957 3:127906988-127907010 ATCACACACCAGGGCCTGTGAGG + Intergenic
961664464 3:128487291-128487313 ATCACACACCCGTGCACATGGGG + Intronic
962150098 3:132883300-132883322 ATTACACATCAGGCCCAATGCGG - Intergenic
962324390 3:134421461-134421483 AAAACACATCAGGGCCACTGAGG - Intergenic
962522596 3:136211002-136211024 ATCACAAAACAGGACAGATGTGG - Intergenic
962870169 3:139481864-139481886 TAATCACATCAGGGCAAATGGGG + Intergenic
963931297 3:151006649-151006671 ATCACACACCAGGGCCTGTGGGG - Intergenic
964187640 3:153965869-153965891 ATCACACACCAGGGCCTGTGTGG + Intergenic
964266563 3:154903609-154903631 ATCACACACCAGGGCCTATTGGG + Intergenic
964343104 3:155729371-155729393 ACCACACAGCAGGGTAAGTGGGG + Intronic
964873092 3:161334821-161334843 CAATCACATCAGGGCAAATGGGG - Intergenic
964994261 3:162855475-162855497 ATCACACACCAGGGCATCTCTGG + Intergenic
965234566 3:166099661-166099683 ATTACACTTTAGGGGAAATGAGG + Intergenic
966057512 3:175713892-175713914 ATCACACACCAGGGCCTATTGGG - Intronic
967197334 3:187039847-187039869 ATCTCACATAAGGGCTCATGTGG - Intronic
967566722 3:190981142-190981164 TTAGCACATCAGGGTAAATGAGG + Intergenic
968559432 4:1270677-1270699 ATCACACAGCAGGGCCCATCGGG - Intergenic
968860103 4:3161083-3161105 ATCACACACCGGGGCCCATGGGG - Intronic
969650553 4:8465274-8465296 ATCGCATATCAGGGCAAAATAGG - Intronic
969858346 4:10017771-10017793 AGGACACATCTGGGGAAATGCGG - Intronic
969858362 4:10017841-10017863 AGGACACATCTGGGGAAATGCGG - Intronic
969858376 4:10017911-10017933 AGGACACATCTGGGGAAATGCGG - Intronic
970062631 4:12051803-12051825 AACACACACCAGGGCCAATCAGG + Intergenic
971641276 4:29136365-29136387 ATCACACATCAGGGCCTGTTGGG - Intergenic
972905166 4:43736960-43736982 TACTCACATCAGGGTAAATGGGG - Intergenic
974720399 4:65730560-65730582 ATCACACACCAGTGCCTATGGGG + Intergenic
975138739 4:70899433-70899455 ATCACACATCAGGGCCTGTCGGG - Intergenic
975179465 4:71327770-71327792 TAATCACATCAGGGCAAATGGGG + Intronic
975526011 4:75351270-75351292 ATCACACATCAGGGCCTGTTGGG - Intergenic
976333736 4:83861990-83862012 ATCACACATCAGGCCTATCGGGG - Intergenic
976995410 4:91426050-91426072 ATCACACATCGGGGCCTATTGGG - Intronic
977494539 4:97758601-97758623 ATCACACATCAGGGCCTGTCAGG + Intronic
977537450 4:98271379-98271401 ATCACAAATCAGGGCTATTTTGG - Intronic
977881699 4:102211952-102211974 CGCACCCAGCAGGGCAAATGGGG - Intergenic
978107452 4:104920539-104920561 ACCACACACCATGGGAAATGTGG - Intergenic
978285913 4:107076269-107076291 ATCACACACCAGGGCCTATCAGG + Intronic
979005100 4:115284441-115284463 ATCACTTATCTAGGCAAATGGGG - Intergenic
979026808 4:115587900-115587922 AACACACAGCAGGGCAAGTTGGG + Intergenic
979488002 4:121290740-121290762 ATCACACACCTGGGCCTATGAGG + Intergenic
979667736 4:123330814-123330836 ATCACACACCAGGGCCTATTTGG - Intergenic
979705809 4:123719033-123719055 ATCACACACCAGGGCCTATTGGG + Intergenic
979729608 4:124008547-124008569 ATCACACATCAGGGCCTGTCTGG - Intergenic
979738186 4:124115972-124115994 ATCACACATGAGGGGAAAGAGGG - Intergenic
980660378 4:135850020-135850042 ATCACACATCAGGGCCTGTTGGG + Intergenic
982738881 4:159037117-159037139 TTAACACTTCAGGGGAAATGCGG + Intronic
983209379 4:164943145-164943167 AACACACATCAGGGCCAGTCAGG + Intergenic
983402580 4:167284129-167284151 AACACACATCAGGGCATGTTGGG - Intergenic
983489615 4:168373104-168373126 GTCACACATCATGTCAAATATGG - Intronic
983676569 4:170301383-170301405 ATAATACATCAGGGTAAATGAGG - Intergenic
983966538 4:173819597-173819619 ATCACACACCAGGGCCTGTGGGG - Intergenic
984163242 4:176279567-176279589 ATCACACACCGGGGCCAGTGGGG - Intergenic
984283702 4:177703249-177703271 ATCACACACCAGGGCATGTCGGG + Intergenic
987444857 5:18005099-18005121 ATCACACACCAGGGCCTGTGGGG - Intergenic
988104079 5:26720681-26720703 ATAACACTTCGGGGAAAATGAGG + Intergenic
988215793 5:28270462-28270484 TTCAGACATCAGGGAAAATACGG - Intergenic
988219017 5:28317267-28317289 ATCACACATCAGGGCCTGTCAGG - Intergenic
988612295 5:32738299-32738321 ATCACACACCAGGGCCTATCAGG - Intronic
988704278 5:33708775-33708797 ATCACACACCAGGGCCTATCAGG + Intronic
988719729 5:33864818-33864840 ATCACACATCAGGGCCTGTAGGG + Intronic
988820256 5:34876817-34876839 ATCACACATCAGGGCCTGTCGGG + Intronic
988968166 5:36440568-36440590 CTCAGACATCTGGGCATATGGGG + Intergenic
989091620 5:37739806-37739828 ATCACACACCAGGGCCAGTCGGG - Intronic
989357551 5:40561554-40561576 ATCACACACCAGGGCCAGTCAGG - Intergenic
990965837 5:61446953-61446975 ATTACCTATCAGTGCAAATGAGG - Intronic
992206771 5:74438186-74438208 ATCACACACCAGGGCCTATCAGG + Intergenic
994155198 5:96495430-96495452 ATCACACATCAGGGCCTATTGGG - Intergenic
994504749 5:100628533-100628555 ATCACACATCAGGGCCTACTCGG - Intergenic
994869790 5:105333136-105333158 TAAACACATCAGGGTAAATGGGG + Intergenic
995771152 5:115671893-115671915 AAATCACATCAGGGCAGATGGGG - Intergenic
995956517 5:117783264-117783286 AACATACATCATGGGAAATGGGG - Intergenic
995983033 5:118131182-118131204 GTCACCCCTCAGGGCAACTGAGG + Intergenic
997601772 5:135143728-135143750 ATCACACACCAGGGCCTATCAGG - Intronic
999469323 5:151837789-151837811 ATCACACACCAGGGCCTATTGGG + Intronic
1000531903 5:162433132-162433154 AACTAACATCAGGGTAAATGGGG + Intergenic
1001672522 5:173485936-173485958 ATCACACACCAGGGCCCATTGGG - Intergenic
1002798996 6:503450-503472 ATACCACATCAGGGTAAATGGGG - Intronic
1003059526 6:2851930-2851952 ATCAGCCAACTGGGCAAATGTGG - Intergenic
1004547392 6:16611377-16611399 ATCACACAAAATGGAAAATGAGG + Intronic
1005170990 6:22984434-22984456 AACACACACCAGGGCCATTGCGG + Intergenic
1005891239 6:30140549-30140571 ATCACACACCAGGGCCTGTGAGG + Intronic
1006222717 6:32507557-32507579 ATCACACATCAGGGCCTGTTGGG - Intergenic
1008225545 6:48910572-48910594 ATCACACATGAGGGCCTATCAGG + Intergenic
1008738141 6:54572347-54572369 ATCACACATCAGGGCCTGTCTGG - Intergenic
1009302945 6:62050272-62050294 ATCACACACCAGGGCCTGTGGGG + Intronic
1009745243 6:67804815-67804837 ATCACACATCAGGGCCTGTCAGG - Intergenic
1009771849 6:68153577-68153599 ATCACACACCAGGGCATATCAGG - Intergenic
1009891593 6:69690678-69690700 TAATCACATCAGGGCAAATGTGG - Intronic
1012211062 6:96519817-96519839 TTATCACATCAGGGTAAATGTGG + Intergenic
1012225445 6:96698444-96698466 TAATCACATCAGGGCAAATGTGG - Intergenic
1012817191 6:104039166-104039188 ATGACACATTAGGGAAAAAGGGG + Intergenic
1012974231 6:105762895-105762917 ATCACACACCAGGGCATGTTGGG + Intergenic
1012995226 6:105966146-105966168 ATAACACATCAGGGAAAATGGGG - Intergenic
1013687820 6:112606039-112606061 TAATCACATCAGGGCAAATGGGG - Intergenic
1013860351 6:114628174-114628196 ATCACACACCGGGGCATATTGGG - Intergenic
1014192665 6:118515911-118515933 ATCACACACCAGGGCCTATCTGG - Intronic
1014868767 6:126564407-126564429 ATCACACATCGGGGCCTATCAGG + Intergenic
1015200319 6:130572398-130572420 ATCACACACCAGGGCCTGTGGGG + Intergenic
1015446356 6:133310076-133310098 ATCACACAGCAGCGAAAGTGAGG + Intronic
1016590643 6:145739704-145739726 ATCACACACCAGGGCCTATCGGG - Intergenic
1017079702 6:150655926-150655948 ATCACACACCAGGGCCTGTGGGG + Intronic
1017259619 6:152371518-152371540 ACCACAAAACAGGGCAAATGGGG + Intronic
1017835916 6:158177732-158177754 ATCACACACCAGGGCCTGTGGGG - Intronic
1018449264 6:163891856-163891878 TTCAGACCTCAGGGAAAATGTGG + Intergenic
1019736627 7:2653085-2653107 AACACAGCTCAGGGCAAATTTGG + Intronic
1019809755 7:3156683-3156705 CTGCCACCTCAGGGCAAATGCGG - Intronic
1020115200 7:5472305-5472327 ATCACTCATCCTGGCAAGTGGGG + Intronic
1020684771 7:11280608-11280630 ATCACACACCAGGGCCTTTGTGG - Intergenic
1020684989 7:11283629-11283651 ATCACACACCAGGGCCTTTGTGG - Intergenic
1020810531 7:12845538-12845560 ATCACACACCAGGGCCTCTGGGG + Intergenic
1020885550 7:13815479-13815501 ATCACACATCAGGGCCTGTCAGG + Intergenic
1021757534 7:23868210-23868232 ATCACACACCAGGGCATGTTAGG - Intergenic
1022839678 7:34151157-34151179 ATCACACAACAGGGTAAAGAGGG + Intronic
1024180151 7:46884103-46884125 AACACAAATCAGGCCAAGTGTGG - Intergenic
1024441140 7:49419317-49419339 ATTTCACAGCAGGGTAAATGAGG + Intergenic
1024517387 7:50270436-50270458 ATTACAGTTCATGGCAAATGGGG + Intergenic
1026125263 7:67573974-67573996 ATCACACACCAGGGCCAGTCGGG + Intergenic
1027433998 7:78144893-78144915 AACACACACCAGAGCACATGGGG - Intronic
1027477770 7:78655031-78655053 AAGTCACATCAGGGTAAATGAGG - Intronic
1028984705 7:97000571-97000593 ATTTCCCATCAGGGCAAATATGG + Intergenic
1030149411 7:106387836-106387858 TACTCACATCAGGGTAAATGGGG - Intergenic
1030154934 7:106445227-106445249 TAATCACATCAGGGCAAATGGGG + Intergenic
1030359520 7:108580222-108580244 CTCCCACAACATGGCAAATGGGG - Intergenic
1030689685 7:112519592-112519614 ATCACACATCAGAGTCACTGTGG + Intergenic
1030705827 7:112691649-112691671 ATCACAGATGAAGGAAAATGAGG + Intergenic
1031530746 7:122873332-122873354 ATCACACACCAGGGCCTATTGGG - Intronic
1031710554 7:125040704-125040726 ATCACACACCAGGGCCTATCGGG + Intergenic
1031864742 7:127026013-127026035 ATCACACATCAGGGCCTGTCAGG - Intronic
1032262669 7:130349627-130349649 TGATCACATCAGGGCAAATGAGG - Intronic
1032544063 7:132727357-132727379 ATCACACTTAAGGGGAAGTGGGG - Intronic
1033440805 7:141376774-141376796 TTCACAAATCAGGGTCAATGGGG + Intronic
1034698520 7:153076354-153076376 ATCACACACCAGGGCATGGGGGG - Intergenic
1036035505 8:5014091-5014113 ATCACACATCAGGGCCTGTCGGG + Intergenic
1037240111 8:16767768-16767790 ATCACACATCGGGGCCTATCAGG + Intergenic
1037543386 8:19893892-19893914 ATCACACATGAGGGCCTATCAGG + Intergenic
1041130924 8:54698867-54698889 ATCACACATCAAGGCCTATCGGG + Intergenic
1041895060 8:62914959-62914981 ATCACACACCAGGGCCTGTGGGG - Intronic
1042132573 8:65602240-65602262 ATCACACACCAGGGCATATCAGG + Intergenic
1042636851 8:70886052-70886074 ATCACACATCAAGGCCTGTGCGG - Intergenic
1042933757 8:74038133-74038155 AAATCACATCAGGGTAAATGGGG + Intergenic
1042949040 8:74182079-74182101 TTTACAAATCAGGCCAAATGTGG + Intergenic
1043614372 8:82107533-82107555 ATCACACATCAGGGCCTGTCAGG - Intergenic
1043845378 8:85157242-85157264 ATCACACACCAGGGCCTATTGGG + Intergenic
1043883749 8:85574557-85574579 AACATAAATCAGGGCAAATGTGG + Intergenic
1044486668 8:92762426-92762448 ATCACACATCAGGGCCTCTCAGG - Intergenic
1044856541 8:96481784-96481806 AGTATACATGAGGGCAAATGGGG - Intergenic
1046771101 8:118117321-118117343 ATCACACTCCTGGACAAATGTGG + Intergenic
1047549149 8:125850810-125850832 ATCACACACCAGGGCCAGTTGGG + Intergenic
1047795686 8:128253192-128253214 TTCACACATAAGGAGAAATGTGG - Intergenic
1047863572 8:128995809-128995831 ATCACACAACAGGGAGGATGGGG + Intergenic
1048197113 8:132340590-132340612 ATCACACACCAGGGCCTATTGGG + Intronic
1050597835 9:7221954-7221976 ATCACACATCAGGGCCTTTTGGG + Intergenic
1051199637 9:14601975-14601997 ATCACACACCAGGGCCAGTCAGG + Intergenic
1051811466 9:21054376-21054398 ATCACACATAAGGAAATATGAGG + Intergenic
1052217842 9:25988554-25988576 ATCACACATCAGGGCCTGTCAGG + Intergenic
1052696180 9:31881899-31881921 ATAACACATCAAGGTAAATGGGG + Intergenic
1052807965 9:33029679-33029701 ATCACAGATGAGGGAAAATCAGG - Intronic
1053100473 9:35367444-35367466 TACTCACATCAGGGTAAATGGGG + Intronic
1053542211 9:38985906-38985928 ATCACACATCAGGGCCTGTAGGG - Intergenic
1053806666 9:41809424-41809446 ATCACACATCAGGGCCTGTAGGG - Intergenic
1053831340 9:42084830-42084852 AGCACACAACAGGGACAATGTGG + Intronic
1054599207 9:67102608-67102630 AGCACACAACAGGGACAATGTGG - Intergenic
1054623929 9:67378005-67378027 ATCACACATCAGGGCCTGTAGGG + Intergenic
1054806441 9:69400439-69400461 ATCACACATTTGGTTAAATGAGG + Intergenic
1055006398 9:71512207-71512229 ATCACACACCAGGGCTTATCGGG - Intergenic
1055580854 9:77705063-77705085 ATCACACATCAGGGCCTGTTGGG - Intergenic
1055867890 9:80838040-80838062 ATCACACACCAGGGCCTATCGGG - Intergenic
1056183856 9:84112177-84112199 ATCACATAACAGGTAAAATGGGG + Intergenic
1056206739 9:84326713-84326735 ATAACACCTCAGGCCAAGTGTGG + Intronic
1056549771 9:87642594-87642616 ATCACACTTCAGGGCTAAGAAGG + Intronic
1058080923 9:100700373-100700395 ATCACACACCAGGGCCTATCGGG + Intergenic
1060374116 9:123103264-123103286 ATCACACATCTGGCCAAAGAAGG - Exonic
1061228486 9:129296260-129296282 ATCACACACCAGGGCCTGTGGGG - Intergenic
1062704730 9:137931555-137931577 ATCACATCTCGGGGGAAATGAGG - Intronic
1203459646 Un_GL000220v1:22311-22333 ATCACACATCAGGGCTTGTCAGG - Intergenic
1203465338 Un_GL000220v1:80649-80671 ATGAAACAGGAGGGCAAATGAGG - Intergenic
1185511778 X:669144-669166 ATCACACACCAGGGCCTGTGGGG - Intergenic
1185723751 X:2402791-2402813 TACTCACATCAGGGCAAATAGGG + Intronic
1186318100 X:8392917-8392939 AACACACACCAGGGCCAATCGGG + Intergenic
1187088487 X:16067703-16067725 ATCACACACCAGGGCCTATTGGG + Intergenic
1187121169 X:16407739-16407761 ATCACACATGAGGACAGCTGAGG + Intergenic
1187121172 X:16407772-16407794 ATCACACATGAGGACAGCTGAGG + Intergenic
1187593929 X:20749819-20749841 TTACCACATCAGGGTAAATGGGG + Intergenic
1187847527 X:23556372-23556394 ACCACTCATCAGGGAAAGTGAGG + Intergenic
1188539409 X:31232754-31232776 ACCACACACCAGGGCGCATGAGG + Intronic
1188781191 X:34287788-34287810 ATCACACATATGGACAATTGTGG + Intergenic
1189084361 X:38004975-38004997 AGATCACATCAGGGTAAATGGGG - Intronic
1189873693 X:45411668-45411690 TAAACACATCATGGCAAATGGGG + Intergenic
1189964374 X:46356791-46356813 TAATCACATCAGGGCAAATGGGG + Intergenic
1190121836 X:47666893-47666915 AAATCACATCAGGGTAAATGGGG + Intergenic
1191027352 X:55928525-55928547 ATCACACATCAGGGCCTGTCAGG - Intergenic
1191071471 X:56405116-56405138 ATCACACACCAGGGCCTTTGGGG - Intergenic
1191096591 X:56679669-56679691 ATCACACATCGGGGCCTGTGGGG + Intergenic
1191160170 X:57321303-57321325 ATCACACATTAGGGCACATTGGG + Intronic
1191803309 X:65105232-65105254 ATCACACATCAGGGCCTGTCGGG + Intergenic
1192029573 X:67494763-67494785 ATCACACACCAGGCCTATTGGGG + Intergenic
1192319360 X:70077091-70077113 ATCACAGAGCAAGGGAAATGGGG + Intergenic
1192407047 X:70896848-70896870 ATCACACACCAGGGCCCATCAGG + Intronic
1192594315 X:72390113-72390135 ATATCACATTAGGGTAAATGGGG + Intronic
1192708261 X:73550904-73550926 ATCACACATCAGGGCTGGTCAGG + Intergenic
1193209397 X:78787993-78788015 GTCACACATAAAGGTAAATGGGG + Intergenic
1193244729 X:79214498-79214520 ATCACACACCAGGGCCATTGGGG - Intergenic
1193342012 X:80359615-80359637 ATCACACACCAGGGCCTATTGGG + Intronic
1194925007 X:99814484-99814506 ATCACACACCAGGGCCTATCAGG - Intergenic
1195494356 X:105512931-105512953 ATCACACACCAGGGCATGTTGGG - Intronic
1195566073 X:106340360-106340382 ATCACACATCAGGGCCTGTCGGG + Intergenic
1195593740 X:106663672-106663694 AAATCACATCAGGGTAAATGGGG - Intronic
1196159558 X:112467791-112467813 ATCACACACCAGGGCCTGTGGGG + Intergenic
1196312980 X:114189873-114189895 ATCACACATCAGGGCCTGTCGGG + Intergenic
1196597685 X:117564196-117564218 ATCACACACCAGGGCCATTTGGG - Intergenic
1196798413 X:119521129-119521151 AAATCACATCAGGGTAAATGGGG - Intergenic
1197571261 X:128153620-128153642 ATCACACACCAGGGCCTGTGCGG + Intergenic
1197621633 X:128757055-128757077 TAAACACATCAGGGTAAATGAGG + Intergenic
1197642389 X:128981292-128981314 ATAGCACATCAGGGTAAATGGGG - Intergenic
1198628198 X:138603154-138603176 ATCACACATCGGGGCCTATCAGG - Intergenic
1198728691 X:139703769-139703791 AACACACACAAGGGAAAATGGGG + Intronic
1198847700 X:140930836-140930858 ATCACAGATCACTGCAACTGTGG + Intergenic
1198875673 X:141223780-141223802 ATCACACACCAGGGCCTATTGGG - Intergenic
1199466298 X:148141455-148141477 ATCACACACCAGGGCCTATTGGG + Intergenic
1200735896 Y:6795067-6795089 ATCACACACTAGGGCCTATGGGG - Intergenic
1201301437 Y:12508347-12508369 ATCACACACCAGGGCCTTTGAGG - Intergenic
1201751618 Y:17438131-17438153 AACAAACATCAGGGCAAATTGGG + Intergenic