ID: 1080653399

View in Genome Browser
Species Human (GRCh38)
Location 11:34240346-34240368
Sequence GGAGTCTCGAGCGATCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080653392_1080653399 24 Left 1080653392 11:34240299-34240321 CCAAGCGGCCAGCAGGAGCAGCT 0: 1
1: 0
2: 1
3: 23
4: 267
Right 1080653399 11:34240346-34240368 GGAGTCTCGAGCGATCCACCTGG 0: 1
1: 0
2: 1
3: 3
4: 102
1080653393_1080653399 16 Left 1080653393 11:34240307-34240329 CCAGCAGGAGCAGCTCAAAGCTG 0: 1
1: 0
2: 1
3: 38
4: 288
Right 1080653399 11:34240346-34240368 GGAGTCTCGAGCGATCCACCTGG 0: 1
1: 0
2: 1
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080653399 Original CRISPR GGAGTCTCGAGCGATCCACC TGG Intronic
902298386 1:15483901-15483923 GGAGTCTCGCTCTATCCCCCTGG - Intronic
903217041 1:21849013-21849035 GTAGCCTCGAGCCATGCACCTGG + Exonic
903586990 1:24423602-24423624 GGAGTCTCGATCTGTCCCCCAGG - Intronic
910800509 1:91140798-91140820 GGAGTCTCGCGCTATCGCCCAGG + Intergenic
911168377 1:94745270-94745292 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
911437727 1:97883673-97883695 CTGGTCTCAAGCGATCCACCTGG + Intronic
915785921 1:158611881-158611903 GGAGTCTTTAGGGATCCACTTGG - Intronic
1071359566 10:84832380-84832402 GGAGTCTCGCGCTGTCCCCCAGG - Intergenic
1071522248 10:86338581-86338603 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1076681261 10:132172677-132172699 GGAGCCTCCAGCGCTCCTCCAGG + Intronic
1077072019 11:679287-679309 GGAGTCTCGCTCCATCCCCCAGG - Intronic
1078186637 11:9057542-9057564 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1080653399 11:34240346-34240368 GGAGTCTCGAGCGATCCACCTGG + Intronic
1081648391 11:44806058-44806080 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1091094840 11:132810663-132810685 GGAGTCTCGCTCCATCAACCAGG - Intronic
1091868285 12:3861997-3862019 GGAGTCTCGCTCCATCAACCAGG - Intronic
1095084965 12:38050844-38050866 GGAGTCTCGCTCTGTCCACCAGG - Intergenic
1096696324 12:53351084-53351106 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1098888549 12:75984312-75984334 GGAGTCTCGTTCCGTCCACCAGG - Intergenic
1100552409 12:95657101-95657123 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1111648627 13:91063057-91063079 GGAGTCTTGAGCCTTCCACGTGG - Intergenic
1112969401 13:105241609-105241631 GGAGTCTTGATCTATCCCCCAGG + Intergenic
1117694804 14:58349686-58349708 GGAGTCTCGCTCTATCGACCAGG - Intronic
1119299937 14:73563567-73563589 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1123822208 15:24042349-24042371 GGAGTCTCGATCTATCGCCCGGG + Intergenic
1125691047 15:41596505-41596527 GGAGTCTCAAGCTATCACCCAGG + Intergenic
1126985020 15:54296224-54296246 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1130003540 15:80069544-80069566 GGAGTCAGGAGAGATACACCAGG + Intronic
1130246588 15:82256136-82256158 GGCGTCTTGTGCTATCCACCAGG + Intronic
1130454072 15:84087204-84087226 GGGGTCTTGTGCTATCCACCAGG - Intergenic
1132361188 15:101217233-101217255 GGAGGCTAGAACGATCCACATGG + Intronic
1133029479 16:3003569-3003591 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1134088261 16:11373368-11373390 GGAGTCTCGCGCTATCACCCAGG + Intronic
1138902182 16:61286406-61286428 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1142175836 16:88644797-88644819 GGAGTCTCGCGCCATCGCCCAGG - Intronic
1143668368 17:8378308-8378330 GGAGTCTCGATTGATCGCCCAGG - Intronic
1148264670 17:46216012-46216034 GGAGTCTCGCTCTATCCCCCAGG - Intronic
1151741460 17:75985374-75985396 CTAGTCTCAAGGGATCCACCTGG + Intronic
1153074600 18:1148218-1148240 GGAGCCTCGAGCTGTGCACCTGG - Intergenic
1158774527 18:60561529-60561551 GGAGTCTAAAGCAATCAACCGGG - Intergenic
1161189986 19:2948857-2948879 GGAGTCTCGAGCTGTCGCCCAGG - Intergenic
1161521171 19:4724190-4724212 GGAGTCTCGCTCGGTCCCCCAGG + Intronic
1161524741 19:4746835-4746857 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1167548453 19:50143362-50143384 GGAGTCTCGCTCTATCCCCCAGG + Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168669058 19:58227668-58227690 GGAGTCTCGCTCTGTCCACCAGG - Intergenic
926025281 2:9537692-9537714 GGAGTCTCGCGCTGTCAACCAGG - Intronic
934485159 2:94700410-94700432 GGAGTCTCGATCTATCGCCCAGG - Intergenic
935957824 2:108396373-108396395 GGAGTCTCGATCCATCACCCAGG + Intergenic
939755579 2:146105250-146105272 GGAGTCTTGAGTGATCCAAGTGG + Intergenic
941081489 2:161066167-161066189 GCACTCTTGAGCGGTCCACCTGG - Intergenic
942029486 2:171944895-171944917 GGAGTCTCGCTCGATCACCCAGG + Intronic
942645907 2:178111269-178111291 GGAGTCTCGCTCTATCCCCCAGG + Intergenic
944853368 2:203743083-203743105 GGAGTCTCGATCTATCGCCCAGG + Intergenic
945087983 2:206153219-206153241 GGAGTCTCGATCTATCTCCCAGG + Intronic
945746080 2:213720769-213720791 GGAGTCTCGCTCTTTCCACCAGG + Intronic
946246336 2:218389866-218389888 GTAGTCTCGAGAGATAGACCGGG + Exonic
1174333573 20:49841229-49841251 GCAGCCTCAAGCGATCCTCCTGG - Intronic
1174856049 20:54046501-54046523 GGAGTCTCGCGCTGTCCACCAGG - Intronic
1175197682 20:57255772-57255794 GGAGTCTCTCGCTATCCCCCAGG - Intronic
1176202895 20:63871269-63871291 CGAGTCTCAAGAGCTCCACCTGG + Intronic
1176886213 21:14258394-14258416 GGAATCTCAAGAGATCCAACTGG - Intergenic
1178312629 21:31542399-31542421 GGAGTCTCGCTCTATCCCCCAGG - Intronic
1182233017 22:28853125-28853147 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1183215525 22:36477231-36477253 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1184130285 22:42513303-42513325 GGAGTCTTGAGCGCTCGGCCTGG + Intronic
1184140463 22:42575131-42575153 GGAGTCTTGAGCGCTCGGCCTGG + Intergenic
1184307548 22:43616637-43616659 GGAGTCTCGTGCTCTCCCCCAGG - Intronic
1184705645 22:46211247-46211269 GGAGGCTAGAACGATCCATCTGG - Intronic
950806016 3:15603629-15603651 GGAGTCTCGATCTGTCCCCCAGG - Intronic
956590098 3:70905580-70905602 GGAGTCTCGCGCTGTCGACCAGG - Intergenic
957239514 3:77640135-77640157 GGAGTCTCGCTCTATCCGCCAGG + Intronic
959143649 3:102517186-102517208 GGAGTCTCGATCTGTCCCCCAGG - Intergenic
967170941 3:186823156-186823178 GGAGTCTCGCTCTATCCCCCAGG + Intergenic
973323804 4:48836995-48837017 GGAGTCTCGCTCTATCCCCCAGG + Intronic
977565458 4:98576041-98576063 GGAGTCTCGCTCTGTCCACCAGG - Intronic
984454804 4:179952229-179952251 GGAGTCTCGCTCGGTCCCCCAGG + Intergenic
984901085 4:184586951-184586973 GGAGTCTCCAGCGATCCTCCAGG + Intergenic
985527396 5:413871-413893 GAAGTCTGGAGTCATCCACCTGG - Intronic
986947170 5:13036785-13036807 GGAGGCTAGAGTGATCCACATGG + Intergenic
987806638 5:22777837-22777859 GGAGTCTCGCTCTATCAACCAGG + Intronic
990245543 5:53859990-53860012 GAAGTCCCGAGGGATCTACCAGG + Intergenic
996556817 5:124786792-124786814 AGAGTCTCGATCTATCCCCCAGG + Intergenic
997197484 5:131989619-131989641 GGAGTCTCGATCTATCACCCAGG + Intronic
1003743068 6:8965257-8965279 GGAGTCTCGCGCTATCGCCCAGG - Intergenic
1006542267 6:34749993-34750015 GGAGTCTCGATCTATCGCCCAGG - Intergenic
1015733787 6:136376122-136376144 GGAGTCTCGCTCTATCCCCCAGG + Intronic
1017542453 6:155416774-155416796 GGAGTCTCGCGCTATCCTCCAGG + Intronic
1020588690 7:10105870-10105892 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1034317356 7:150145022-150145044 GGAGTCTCGCACTGTCCACCAGG - Intergenic
1034881108 7:154763304-154763326 GGAGTCTCGATCTATCATCCAGG - Intronic
1036800885 8:11789950-11789972 GGAGTCGCGAGCGAACAAGCAGG + Intergenic
1038333555 8:26628673-26628695 GGAATCTCCAGGGAACCACCAGG + Intronic
1040084749 8:43327966-43327988 GGAGTCTCGATCTATCACCCAGG + Intergenic
1043328799 8:79087083-79087105 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1044322182 8:90815038-90815060 GGAGTCTAGAACGATCCATGTGG - Intronic
1044713528 8:95078998-95079020 GGAGTCTTGCTCTATCCACCAGG + Intronic
1050317922 9:4422485-4422507 GGAGTCTAGTGGGATCCACCTGG + Intergenic
1051136264 9:13925325-13925347 GGAGAGTCGAGCCCTCCACCCGG + Intergenic
1059307539 9:113366602-113366624 GAAGTCTACAGCGAACCACCCGG - Intronic
1060592620 9:124828205-124828227 GGAGTCTCGCTCCATCGACCAGG - Intergenic
1061095330 9:128453573-128453595 GGAGTCTCGCTCTATCCTCCAGG + Intergenic
1189991956 X:46603811-46603833 GGAGTCTCGCTCTATCCCCCAGG - Intronic
1190104656 X:47550839-47550861 GGAGTCTCGCTCTATCCCCCAGG - Intergenic
1192421899 X:71040154-71040176 GGAGTCTCGATCTATCACCCTGG - Intergenic
1198894198 X:141432602-141432624 GGAGTCTCGCTCTGTCCACCAGG - Intergenic
1200132615 X:153859401-153859423 GGAGTCTCGCTCGATCACCCAGG - Intergenic