ID: 1080660096

View in Genome Browser
Species Human (GRCh38)
Location 11:34288843-34288865
Sequence ATGCAGGAACGTCCAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080660096_1080660100 17 Left 1080660096 11:34288843-34288865 CCTTCCTCTGGACGTTCCTGCAT 0: 1
1: 0
2: 3
3: 12
4: 140
Right 1080660100 11:34288883-34288905 AGTGACCTTCATAGTCCCTCTGG 0: 1
1: 0
2: 1
3: 8
4: 111
1080660096_1080660101 18 Left 1080660096 11:34288843-34288865 CCTTCCTCTGGACGTTCCTGCAT 0: 1
1: 0
2: 3
3: 12
4: 140
Right 1080660101 11:34288884-34288906 GTGACCTTCATAGTCCCTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080660096 Original CRISPR ATGCAGGAACGTCCAGAGGA AGG (reversed) Intronic
903479795 1:23644942-23644964 ATGTTGGAAGATCCAGAGGAAGG - Intergenic
904591566 1:31618079-31618101 GTGCAGGAAGGTCCCGCGGACGG + Intronic
905081456 1:35324724-35324746 AAGCAGGAACCTCCAAAGTAAGG + Intronic
905150180 1:35921081-35921103 GTGCAGGACAGTGCAGAGGAGGG - Exonic
905660050 1:39714925-39714947 ATTCAGCAACCTCCACAGGAAGG - Intronic
908784679 1:67723233-67723255 ATGAAGAAAAGTGCAGAGGATGG + Intronic
910302069 1:85717225-85717247 AGGCTGGAAAGTCCAGAGCATGG - Intergenic
911148994 1:94579498-94579520 ATGGAGGACCTTCCAGAGGAAGG - Intergenic
916276972 1:163004922-163004944 ATGCAGGAAAGGCTCGAGGAGGG + Intergenic
922532893 1:226357849-226357871 CTGCAGCAATGTGCAGAGGAGGG - Intergenic
923019199 1:230149806-230149828 AGGCAGGAAAGACCAGAGGGAGG - Intronic
1065120514 10:22525787-22525809 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1065120885 10:22529733-22529755 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1066053029 10:31653924-31653946 ATGCAGGTAAGTTAAGAGGATGG + Intergenic
1067561431 10:47307500-47307522 ATGCAGAAACATCCAGAGAGAGG + Intronic
1070645864 10:78202068-78202090 ATGCATGAACGTCCAGAGGCAGG + Intergenic
1075092699 10:119452495-119452517 ATGCAGGTGAGTCCAGGGGAGGG - Intronic
1076272581 10:129166854-129166876 AGGCAGGAAGCTCCAGAGGTGGG + Intergenic
1076810490 10:132884125-132884147 AAGCAGGAAGGGCCTGAGGAGGG - Intronic
1080660096 11:34288843-34288865 ATGCAGGAACGTCCAGAGGAAGG - Intronic
1082662156 11:55924958-55924980 AGTCAGGAACGCCCAGTGGAGGG - Intergenic
1083958139 11:65998228-65998250 ATGCAAGAAGGCCCAGAGCACGG + Exonic
1084316187 11:68347228-68347250 ATGTAGGAATGTCCAGAAGCAGG + Intronic
1085643428 11:78207693-78207715 ATGCAGGCAGGTCCTGGGGAAGG - Intronic
1087623199 11:100565884-100565906 AAAAAGGAAAGTCCAGAGGAGGG - Intergenic
1089765940 11:120765811-120765833 ATGATGAAACTTCCAGAGGAAGG - Intronic
1095477036 12:42596153-42596175 TTGGAGGAACCTGCAGAGGAGGG + Intergenic
1096813946 12:54189726-54189748 ATTCAGGAAAGTCCAAAGCAGGG + Intergenic
1097015715 12:55985690-55985712 ATGCAGAAGTCTCCAGAGGATGG - Intronic
1097170443 12:57109980-57110002 GAGCAGAAACGTCCAGAGAAGGG - Intronic
1098916724 12:76264779-76264801 ATGCAAGAAGTTCAAGAGGAGGG + Intergenic
1100409079 12:94296623-94296645 TTGCAGGAAGGTCCAAAGGTAGG - Intronic
1101824257 12:108208431-108208453 GTGCAGGAAAGTCAAGAAGATGG + Intronic
1103899129 12:124294545-124294567 ATGCAGGAACAGCCAGATGCCGG + Intronic
1104073615 12:125370217-125370239 AGGCAGGAATGTCCACAGGTAGG + Intronic
1104942158 12:132400241-132400263 AGGCAGGAACACCCAGAGGCCGG - Intergenic
1107950053 13:45453494-45453516 ATCCAGGCAAGTCCAGAGGCAGG - Intergenic
1113259825 13:108549324-108549346 ATGCAGGCACATCCAGAAGCTGG + Intergenic
1113973576 13:114209574-114209596 AGGAAGGAAGGTCTAGAGGAAGG + Intergenic
1115901548 14:38156524-38156546 ATGCATGAACTTCCAGTGGAGGG + Intergenic
1118309771 14:64683624-64683646 AGGCAGGGACCTCCAGGGGAAGG - Intergenic
1119780821 14:77275816-77275838 ATGCAGCAACGTCAAAAGCAAGG - Exonic
1120700124 14:87690420-87690442 AAGCAGGCAAGTGCAGAGGAAGG + Intergenic
1121871134 14:97408354-97408376 ATGCAGGACCGTACAGAGGATGG + Intergenic
1125775160 15:42206220-42206242 GTCCAGGAACTTCCAGAGGCAGG - Intronic
1126290623 15:47072914-47072936 ATGGAGGAAGGCCCACAGGATGG - Intergenic
1127503166 15:59573493-59573515 AGGCAAGAGCGTCCAAAGGAAGG + Intergenic
1135972780 16:27084559-27084581 ATGTAAGAAAGTCCAGAGGAGGG + Intergenic
1141631335 16:85289670-85289692 ATACAGGAGGGTGCAGAGGACGG + Intergenic
1142026444 16:87816642-87816664 CTTCGGCAACGTCCAGAGGAAGG + Intergenic
1142816823 17:2433096-2433118 ATGCAGTTAAGTCCAGAGGAAGG + Intronic
1143381298 17:6498001-6498023 ATCCAGGAACGTCCGGTGGGAGG - Intronic
1143996500 17:11011160-11011182 ATGCAGGAAAGCCCAAAGGCAGG + Intergenic
1144631054 17:16872684-16872706 ATGCAGGAAGCCCCAGGGGAGGG - Intergenic
1144650259 17:17002792-17002814 ATGCAGGAAGCCCCAGGGGAGGG + Intergenic
1145040875 17:19577419-19577441 TTGCCGGAACATCCACAGGACGG + Exonic
1147684703 17:42280193-42280215 ATGCAGCAATGTCCACTGGAGGG + Intergenic
1149413993 17:56439161-56439183 ATGCAGGATCATCCAGAGCAAGG + Intronic
1152451469 17:80383903-80383925 CTGCAGGAAATGCCAGAGGATGG - Exonic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1153882780 18:9435143-9435165 GTGCAGGAACGTCTAGAGATGGG - Intergenic
1161064835 19:2232505-2232527 ATGCAGGGGTGCCCAGAGGAAGG - Exonic
1161586489 19:5108501-5108523 CTGCAGGAAATTCCACAGGAAGG + Intronic
1164779390 19:30880387-30880409 GTGCAGGGACATCCTGAGGAAGG + Intergenic
1165997763 19:39856711-39856733 ATGAAGGAATGTCCACAGCAGGG + Intergenic
1167384340 19:49155368-49155390 AGGCAGCAAGGACCAGAGGAAGG - Exonic
925125795 2:1455036-1455058 ATGCAGGCACCTCCAGAAGCTGG - Intronic
925951652 2:8919040-8919062 ATGGAGGAACCTCAAGAGCACGG - Intronic
926386646 2:12341968-12341990 ATGCAGGAAATTCCACATGAGGG + Intergenic
928374608 2:30764495-30764517 GGGCAGGAAGGTACAGAGGATGG - Intronic
928724320 2:34153607-34153629 ATGCAAGAACTTCTAAAGGAAGG - Intergenic
931086064 2:58831765-58831787 ATGCAGCCACTGCCAGAGGATGG + Intergenic
933813346 2:86047148-86047170 ATGCAGGTATGTGCAGAGGCGGG - Exonic
934038831 2:88110855-88110877 ATGGAGGAGGGTGCAGAGGAGGG + Exonic
934121868 2:88847940-88847962 ATGCAGAGAGGTCCACAGGAGGG - Intergenic
938406679 2:131036717-131036739 AGGCAGGAACCTCCTGAGAAGGG + Intronic
939707048 2:145468067-145468089 CTGCAGGAGCGACCAGAGGATGG - Intergenic
943869103 2:192970183-192970205 ATGCAGAAAAGTCAAGCGGAAGG + Intergenic
948696378 2:239735033-239735055 ATGCAGGAGCATGCAGAGGCTGG + Intergenic
1170872245 20:20216980-20217002 AAGCAGAAACGTCAACAGGAAGG - Intronic
1170903502 20:20489019-20489041 ATGCATGAAAGGCCAGGGGAAGG + Intronic
1171110366 20:22475403-22475425 ATGCAAGTACGTCCACAGGAAGG + Intergenic
1171429821 20:25075666-25075688 ATGCAGAAACGACTAGAGTATGG + Exonic
1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG + Exonic
1172955584 20:38755851-38755873 TTTCAGGAACTTCTAGAGGATGG + Exonic
1174707390 20:52670374-52670396 ATGCAGAAATTTCCAGAGGAAGG - Intergenic
1175535835 20:59710776-59710798 ATGCAGGAACATCAAGAAGTGGG - Intronic
1175900218 20:62357098-62357120 TGGCTGGAACCTCCAGAGGAGGG + Intronic
1175938423 20:62525889-62525911 ACGCAGGCACTTCCAGAGGCAGG - Intergenic
1179055177 21:37925213-37925235 CTGGAGGAAGATCCAGAGGAAGG - Intergenic
1179637317 21:42721466-42721488 AGGCAGGACAGGCCAGAGGAAGG + Intronic
1184497503 22:44850541-44850563 AAGCAGGAACCTACAGAGGCTGG - Intronic
1184835414 22:47018137-47018159 AAGCAGGAACGGCCAGAGTCAGG - Intronic
949933769 3:9100959-9100981 AGGCAGGAAGGACCAGTGGATGG + Intronic
950018291 3:9769304-9769326 ATACAGGAGCTTCCAGGGGATGG - Intronic
956429239 3:69167774-69167796 ACCCAGGGAAGTCCAGAGGAGGG + Intergenic
958997836 3:100926414-100926436 ACGCAAGAACTTCAAGAGGATGG + Exonic
967404189 3:189098503-189098525 AGACAAGAACGTCCAGGGGATGG + Intronic
970128263 4:12838692-12838714 ATCCAGGACCATACAGAGGAAGG + Intergenic
975728124 4:77312199-77312221 TTGCAGGAACATGCAGGGGAAGG + Intronic
975746371 4:77479449-77479471 TTGCAGGAAAATGCAGAGGAGGG + Intergenic
978545615 4:109869647-109869669 ATACAAGAATCTCCAGAGGAAGG + Exonic
982976962 4:162075937-162075959 AAGCAGGAGTGTGCAGAGGAAGG - Intronic
985614382 5:910777-910799 CTGCAGGAAGGGCCAGAGGGAGG - Intronic
987230698 5:15890665-15890687 ATGCAGGGAGGGGCAGAGGATGG - Intronic
990511385 5:56492429-56492451 ATGCAGAAATTTCCAGAGAAGGG + Intergenic
998587859 5:143447136-143447158 ATGCATGAAGGATCAGAGGATGG - Intergenic
999563150 5:152827074-152827096 ATACAGAAACGCCCAGAGGAAGG - Intergenic
999701874 5:154235597-154235619 ATGACGGAATGTCCAGAAGAAGG - Intronic
1002301108 5:178257626-178257648 GTGCTGGGAAGTCCAGAGGAGGG - Intronic
1005856445 6:29866646-29866668 ATGCAGGAACATCCTGAGAGAGG - Intergenic
1005862279 6:29910976-29910998 GTGCAGGAACATCCTGAGGGAGG - Intergenic
1006042388 6:31267201-31267223 TGGCAGGAGCGTCCTGAGGAGGG - Intergenic
1006051975 6:31352289-31352311 TGGCAGGAGCGTCCTGAGGAGGG - Intronic
1007502051 6:42305757-42305779 ATGCAGGAAAATGGAGAGGAGGG + Intronic
1007593125 6:43035467-43035489 AAGCAAGAAAGTCCAGAGAAGGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008142260 6:47845584-47845606 ATGCAGGAAAATCACGAGGAAGG - Intergenic
1008387138 6:50904731-50904753 CTGAATGAACATCCAGAGGATGG - Intergenic
1010599529 6:77806626-77806648 ATGGAGGAACTTCTAGAGCATGG + Intronic
1014755745 6:125300614-125300636 ATACAGAAATGTCCAGAGGCCGG - Exonic
1017656450 6:156633987-156634009 ATGGAGCAAGGTCCAGGGGAAGG + Intergenic
1017657634 6:156645418-156645440 AGGCAGGAACCTCCTGAGTAAGG + Intergenic
1018044212 6:159951852-159951874 ATACAGGAAGGTCCCGGGGAAGG - Intergenic
1019075637 6:169385943-169385965 TTGGAGGAGCCTCCAGAGGATGG - Intergenic
1019785526 7:2974702-2974724 AAGCATGAACGTCCAGAACACGG - Intronic
1028177150 7:87672386-87672408 AGGGAGGAGCGTCCAGGGGAGGG - Intronic
1029403734 7:100360661-100360683 ATGGAGGAATGGCCAGAGGTGGG + Intronic
1029690100 7:102175571-102175593 ATGCAGGCAGGTGCAGAGGCTGG - Intronic
1029929820 7:104359051-104359073 ATGCAGGCTCATCCAGGGGAAGG - Intronic
1032197509 7:129797858-129797880 ATGCAGGAACCTGCAGCCGACGG - Intergenic
1032778916 7:135146195-135146217 ATGGAGGAACGTCCAGTTGGTGG + Intronic
1033649522 7:143330294-143330316 CGGTAGGAAAGTCCAGAGGAGGG + Intronic
1034447996 7:151123139-151123161 ATGCAGGAAGGAGCAGAGGAGGG - Intronic
1036119222 8:5997167-5997189 AATCAGGAACTTCCAAAGGAAGG - Intergenic
1036190186 8:6663000-6663022 TTGCTGGAACTTCCAGTGGAAGG + Intergenic
1036417735 8:8566050-8566072 TTGCTGGAACGTTCAGAGGACGG + Intergenic
1040469334 8:47724320-47724342 ATGCAGGAATGTCCATAGCAAGG + Intronic
1040690914 8:49937316-49937338 AAGCAGGAACGTCAGGAGAAAGG + Intronic
1041005646 8:53494941-53494963 GTGCAGGAAGGCCTAGAGGAGGG + Intergenic
1041105920 8:54443980-54444002 AAGCAGGAACTTCCAAAAGAAGG - Intergenic
1041207282 8:55511566-55511588 ATTCAGGAAAATCCTGAGGAAGG + Intronic
1041749465 8:61244127-61244149 ATGCAGAGATGACCAGAGGATGG + Intronic
1043918198 8:85949084-85949106 ATGGAGGAAAGTCCCGTGGAAGG - Intergenic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1048694060 8:137004324-137004346 AGGCAGTAATGTACAGAGGAAGG + Intergenic
1050876198 9:10640019-10640041 ATGGTGGAAGGTACAGAGGAAGG + Intergenic
1056923992 9:90817200-90817222 ATCCAGGAACCTCTAGAGCAGGG - Intronic
1058139824 9:101345558-101345580 ATGCTGGAGGGCCCAGAGGAAGG - Intergenic
1058806094 9:108593632-108593654 ATGGAGGAAGGTGAAGAGGAAGG + Intergenic
1060677069 9:125524892-125524914 ATGCAGGGTGCTCCAGAGGAAGG + Intronic
1061081041 9:128370516-128370538 ATGCTGGAACATGGAGAGGAAGG - Intergenic
1061451570 9:130669885-130669907 AGCCAGGAAGGTTCAGAGGAGGG + Intronic
1186012734 X:5154060-5154082 ATGCAAGCACCACCAGAGGAAGG - Intergenic
1195877615 X:109558322-109558344 CTGCTGGAACTTCCAGAGGGTGG + Intergenic
1197961200 X:132007893-132007915 GTTCAGAAACCTCCAGAGGAAGG - Intergenic