ID: 1080661497

View in Genome Browser
Species Human (GRCh38)
Location 11:34299934-34299956
Sequence CACTGCTGCCTCCTTCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080661496_1080661497 -6 Left 1080661496 11:34299917-34299939 CCGTAAAATGGGAATAACACTGC 0: 1
1: 1
2: 7
3: 72
4: 417
Right 1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG 0: 1
1: 1
2: 2
3: 36
4: 324
1080661492_1080661497 18 Left 1080661492 11:34299893-34299915 CCTCTTTGTGCTCCAGTTTCATC 0: 1
1: 3
2: 24
3: 255
4: 1682
Right 1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG 0: 1
1: 1
2: 2
3: 36
4: 324
1080661493_1080661497 6 Left 1080661493 11:34299905-34299927 CCAGTTTCATCTCCGTAAAATGG 0: 1
1: 0
2: 3
3: 30
4: 255
Right 1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG 0: 1
1: 1
2: 2
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080661497 Original CRISPR CACTGCTGCCTCCTTCATAA AGG Intronic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
901941223 1:12663436-12663458 CTCTAATGCCTCCTTCATAAGGG + Intronic
902085080 1:13853745-13853767 CTCTCCTGCCTCCCTCCTAAAGG + Intergenic
902810094 1:18883197-18883219 CACCGCTGCCTCCTTCCCCAGGG - Exonic
903046639 1:20569355-20569377 CACCACTGCCTCCTTCACACTGG - Intergenic
904001230 1:27339921-27339943 TGATGCTGCCTCCTTCATTAAGG - Intergenic
904279257 1:29407312-29407334 TAATAGTGCCTCCTTCATAATGG - Intergenic
904451861 1:30618452-30618474 CTCTGCTGCCTCATTCATCCAGG - Intergenic
904610596 1:31724174-31724196 CACTGATGCCTGCTTCATGTGGG + Intergenic
905733201 1:40310405-40310427 CTCTGCTGCCTACCTCAAAAGGG - Intronic
905785658 1:40755120-40755142 AACTGCTGCCTCCTTCAGAAAGG - Intronic
907910140 1:58818283-58818305 CACAGCTGCCTCCTCAACAAAGG + Intergenic
908584812 1:65556105-65556127 CGCTGCAGCCTCTTTTATAAGGG - Intronic
911173600 1:94796192-94796214 CACAGCTGGCTCCTTCTAAAGGG + Intergenic
911669356 1:100591104-100591126 CTCTGAGGCCTCTTTCATAAAGG + Intergenic
912937735 1:114018692-114018714 TACTGCTGCTTCCTTCCTACAGG + Intergenic
913421544 1:118675408-118675430 CACTCCTGCCTCCTTGCAAAAGG - Intergenic
913477150 1:119249062-119249084 CATGGCTGCCTCCTTTAGAAGGG + Intergenic
916298661 1:163248953-163248975 CCCCTCTGCCTGCTTCATAATGG + Intronic
916887406 1:169083319-169083341 GTCTGCTGCCTCATTCCTAATGG - Intergenic
917652955 1:177096873-177096895 CACTGGGGCCTCTTTTATAAGGG - Intronic
918561984 1:185880006-185880028 CACTCCTGCCTGCTTCACAATGG - Intronic
919900615 1:202041730-202041752 CACTGCAGGCTCCTTCTGAAAGG - Intergenic
921179424 1:212619878-212619900 CACTGCTGCCTGAATCCTAACGG - Exonic
921182690 1:212644230-212644252 CACTGCTCCCTCCCTGATCATGG + Intergenic
921880733 1:220252078-220252100 CACTGCTGCCTCCACCATCTGGG - Intronic
922638765 1:227205191-227205213 CACTGCAGCCTCCTCCTTCAGGG - Intronic
923491303 1:234486414-234486436 CACTGCTTCCTTCTTAGTAAGGG + Intergenic
924790810 1:247245944-247245966 CTCTGCTGTCACCTTTATAAAGG - Intergenic
1062853928 10:769828-769850 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1063728878 10:8672531-8672553 CTCTGATGCCTCTTTTATAAGGG + Intergenic
1063904257 10:10766471-10766493 CACTGCTGCCTCCATCGGGAGGG + Intergenic
1063925139 10:10970142-10970164 CACTGCAGCCTCCTTCTTGCAGG + Intergenic
1063936387 10:11083030-11083052 CATGGCTGACTCCTTCATGAAGG - Intronic
1064087154 10:12353695-12353717 CAGTGCAGCCTCCTACAAAAGGG + Intronic
1064874739 10:19980472-19980494 ATCTGCTGCCACCTTGATAATGG - Intronic
1065288409 10:24207102-24207124 CTCTGCTGCCTCCTTCATCCTGG + Intronic
1065494236 10:26312451-26312473 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1065754354 10:28917381-28917403 CAGTCCTTCCTCCTGCATAAAGG - Intergenic
1066350942 10:34636336-34636358 CACTGCTGCCTCCTCCATCCGGG + Intronic
1066444347 10:35468221-35468243 CTCTGGGGCCTCTTTCATAAGGG + Intronic
1066539379 10:36428847-36428869 CTCTGGGGCCTCCTTCACAAGGG - Intergenic
1067352633 10:45490481-45490503 CCCTGCTGCCACCTTCATCTTGG + Intronic
1068536836 10:58249294-58249316 CACTGCAGCCTCCATCCTCAGGG + Intronic
1068551709 10:58414881-58414903 CACTGCTCCCTTCTTCCTCATGG + Intergenic
1070438525 10:76417536-76417558 CACTACTTCTTCCTCCATAAAGG + Intronic
1070562034 10:77575446-77575468 CAATCCTGCCTCCTCCAAAACGG + Intronic
1070807925 10:79281511-79281533 CCCTGCTGCCTCCATCACCATGG + Intronic
1071026617 10:81122045-81122067 TATTGCTGACTCCGTCATAAGGG + Intergenic
1072102373 10:92240778-92240800 TACTGCTGCGTCCTTCAGCAAGG + Intronic
1072619551 10:97070625-97070647 CTCTGCGGTCTCTTTCATAAGGG - Intronic
1072900762 10:99404556-99404578 CACTGCTACCTACTTCATCCAGG + Intronic
1074147611 10:110730487-110730509 CAATGCTGCCTCCTTCTTCTAGG - Intronic
1074405151 10:113175110-113175132 CACAGCAGCTTCATTCATAATGG + Intergenic
1076271466 10:129155882-129155904 AAATGCTGTCTCTTTCATAAGGG - Intergenic
1076295530 10:129380935-129380957 CTCTGGAGCCTCTTTCATAAGGG - Intergenic
1077009102 11:372295-372317 CCCTGCTGCGTCCTCCAGAATGG - Intronic
1077198312 11:1292683-1292705 CACCGCTGCCTCCCCCACAACGG + Intronic
1078154717 11:8789533-8789555 ATCTGCTGCATCATTCATAAAGG + Intronic
1078442591 11:11379660-11379682 CACGGCTACCTCCTTCCTATTGG + Intronic
1080661497 11:34299934-34299956 CACTGCTGCCTCCTTCATAAAGG + Intronic
1082200712 11:49363232-49363254 CACTGCCCCCTCCTTCCTACTGG - Intergenic
1083389294 11:62336335-62336357 CTCTCCTGCCTCCTTCTTAAAGG - Intergenic
1084950319 11:72661577-72661599 GACTTCTGCCTCCTTGATAGGGG - Intronic
1086664850 11:89467610-89467632 CTCTGAAGCCTCTTTCATAAAGG + Intronic
1087450363 11:98313642-98313664 CTTTGCTGTCTCCTTCATTATGG - Intergenic
1087676546 11:101169144-101169166 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1088112976 11:106283087-106283109 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1088713430 11:112528155-112528177 CTCTGCGGCCTCTTTTATAAGGG - Intergenic
1088829320 11:113521976-113521998 CACTGCTGCTTCCTGCATTTGGG - Intergenic
1090000926 11:122957213-122957235 CACTGCTGCCACCTTACTCAAGG + Intronic
1091521592 12:1249887-1249909 CTCTGCAGCCTCTTTTATAAGGG + Intronic
1092242385 12:6843264-6843286 CACCACTGCATCCTTCCTAAGGG + Intronic
1093096775 12:14981075-14981097 CACTTCTGCCTCCTCCTTAGTGG + Intronic
1093135468 12:15444662-15444684 CTCTGGGGCCTCCTTTATAAGGG - Intronic
1094590901 12:31819252-31819274 CACTGCTGCCTCCACCTTCAGGG + Intergenic
1094592951 12:31838268-31838290 CTCTGAGGCCTCTTTCATAAGGG + Intergenic
1095963692 12:47852087-47852109 CAATGCTGCCCCCTTCACTAAGG - Intronic
1098198091 12:68023714-68023736 CACTGCTGGCTCCTTGATCTTGG - Intergenic
1099298815 12:80865987-80866009 CACTGCTGAATCCTTGATTAAGG - Intronic
1101087683 12:101253188-101253210 CACTGCGTCCTTTTTCATAATGG - Intergenic
1101874228 12:108588272-108588294 CCCTGCTGCCCCCTTCCCAAGGG + Intergenic
1102764164 12:115417141-115417163 CACTGCTGCATCTTCCAAAAAGG + Intergenic
1103910286 12:124348392-124348414 CACTGCTGGCTCCTGCCTACCGG - Intronic
1105539923 13:21307465-21307487 CACTGCTGACTCCTTCCCAGGGG - Intergenic
1105798402 13:23880585-23880607 CACTGCTGACTCCTTCCCAGGGG + Intronic
1106158847 13:27182961-27182983 CCCTGCTGCCTTCTGAATAAAGG + Intergenic
1106407807 13:29488876-29488898 AAATGCTGCCTCTTTCACAAAGG - Intronic
1106509019 13:30397178-30397200 CACAGCAGCATCCTTCACAATGG - Intergenic
1106690288 13:32107779-32107801 CTCTGCTGCCTGCTCCATGAAGG - Intronic
1107328221 13:39268573-39268595 TACTGCAGCCTCCTTCCTGATGG + Intergenic
1108587316 13:51881682-51881704 CTCTGGGGCCTCCTTAATAAGGG - Intergenic
1108742623 13:53354512-53354534 CAGTGCTGAATCCTTCTTAAAGG - Intergenic
1109428262 13:62197516-62197538 CATTGCTGCATCCTTCAGAGGGG + Intergenic
1110256252 13:73437024-73437046 CACTCATGACTCCTTCCTAAGGG + Intergenic
1110374541 13:74777335-74777357 CCCTGCTGCCTTCCTCATATTGG + Intergenic
1111618912 13:90698061-90698083 CACTGCTGCCTCCATCACCCCGG - Intergenic
1118385587 14:65253168-65253190 CACCCCTGCCTCCTTGATGATGG + Intergenic
1118890879 14:69907896-69907918 CACTCTGGCCTCCTTTATAAAGG + Intronic
1119246889 14:73117866-73117888 CATAGCTGCCCCCTTCAGAAGGG + Intronic
1121475484 14:94197489-94197511 CACTGCTGCCATCTTCATAGGGG + Intronic
1121579553 14:95017530-95017552 CCCTCCTGCCTCTTTTATAAGGG + Intergenic
1121692651 14:95889045-95889067 CTCTGCTTCCTTCTTCAGAAAGG - Intergenic
1121814887 14:96921600-96921622 CCCTGCTGCCTTTCTCATAAGGG + Intronic
1121884708 14:97532847-97532869 CTCTGTGGCCTCCTTTATAAGGG + Intergenic
1122348777 14:101076137-101076159 CACTCCTTCCTCCCTCATTAGGG - Intergenic
1123049459 14:105533719-105533741 CACTGCGGCCTCCTGGGTAATGG - Intergenic
1123160799 14:106276486-106276508 CACAGCTGCCTCATTCCTCAGGG + Intergenic
1123195196 14:106609702-106609724 CACAGCTGCCTCCTTCCTCAGGG + Intergenic
1123208524 14:106737050-106737072 CACAGCTGCCTCCTTCCTCAGGG + Intergenic
1202947095 14_KI270726v1_random:38649-38671 CACAGCTGCCTCCTCCCTCAGGG - Intergenic
1123481809 15:20639404-20639426 CACAGCTGCCTCCTTCCTCAAGG + Intergenic
1123636204 15:22360961-22360983 CACAGCTGCCTCCTTCCTCAAGG - Intergenic
1124055212 15:26235683-26235705 CCCTGCTGCCTCCTGCACACTGG + Intergenic
1127191188 15:56532261-56532283 CACAGCTGCCACCATCAAAATGG + Intergenic
1128173952 15:65537275-65537297 CAGTGCAGCCACCTTCATCAAGG - Intronic
1129257384 15:74341648-74341670 CACTGCTGCCTCCCTGTTATAGG + Intronic
1130786634 15:87104599-87104621 CACTGCTGCCTCCATCCAAGGGG + Intergenic
1131004704 15:88967894-88967916 CACTGCAGCATCATTCATAATGG - Intergenic
1131913536 15:97235499-97235521 CACTGCAGCCTGCTTTATGAAGG - Intergenic
1132319869 15:100918248-100918270 CACTGCTGGCTCCTGCAAACTGG + Intergenic
1133435658 16:5777311-5777333 CCCTGCTGCCTTCTTCTGAAGGG + Intergenic
1134007145 16:10825649-10825671 CACTGCTGCCTGTTTCACAGAGG + Intergenic
1134461414 16:14432643-14432665 CACAGCAGCCTTATTCATAATGG + Intergenic
1134806762 16:17132463-17132485 CACTGTTGGCTGCATCATAATGG + Intronic
1135626152 16:23996533-23996555 AAATGCTGCCTCTTCCATAATGG - Intronic
1135950338 16:26908473-26908495 CACTGCAGCATCATTCACAATGG - Intergenic
1137548139 16:49418203-49418225 CACTGCCGCCTCCTCCAGGAAGG - Intergenic
1138308435 16:56001627-56001649 CACAGCCTCCTCCTTCTTAAGGG - Intergenic
1139148643 16:64352692-64352714 CTCTCCAGCCTCTTTCATAAGGG - Intergenic
1139391280 16:66607354-66607376 CCCTGCTGCCTTATTCATACAGG - Intronic
1139555599 16:67707582-67707604 CACAGCAGCCTTATTCATAATGG + Intronic
1141619234 16:85228025-85228047 GACTGCTGCCTCCTCCACAGAGG - Intergenic
1141687970 16:85581178-85581200 CTCTCCAGCCTCCTTCAGAAGGG + Intergenic
1141877417 16:86835453-86835475 CCCTGCTGCCTCCTTCCTTTGGG - Intergenic
1143124309 17:4631845-4631867 CACAGCTGCCTCCTTCCTTAGGG + Intronic
1144174864 17:12695310-12695332 CTCTGAAGCCTCCTTTATAAGGG + Intronic
1145272702 17:21413220-21413242 CATTGCTGCCTCCTGCCTATGGG + Intronic
1145310910 17:21700683-21700705 CATTGCTGCCTCCTGCCTATGGG + Intronic
1146607749 17:34275922-34275944 CACTTCTGCCTACTTCACATTGG - Intergenic
1148687266 17:49507891-49507913 CTCTGCTGCCTCCATCAGAATGG - Intronic
1149239217 17:54629450-54629472 CACTGGAGCCTCTTTTATAAGGG + Intergenic
1149286066 17:55165780-55165802 CCCTGAAGCCTCTTTCATAAGGG - Intergenic
1151908643 17:77066571-77066593 GACAGCTGCCTGCTTCAAAATGG + Intergenic
1152150419 17:78596614-78596636 CACCTCAGCCTCCTGCATAATGG + Intergenic
1153289389 18:3485510-3485532 CACTGCTCCCACCTTCCTCACGG + Intergenic
1154013325 18:10594253-10594275 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1154152498 18:11917516-11917538 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1156685291 18:39637658-39637680 CCCTCATGCCTCCTTTATAAGGG - Intergenic
1157022169 18:43797171-43797193 CACTGCAGCCTCCTTCTTGTGGG - Intergenic
1157123788 18:44936330-44936352 CACTGCTGCATCCTTCCAGAAGG - Intronic
1158948075 18:62465007-62465029 CTCTGGAGCCTCTTTCATAAGGG + Intergenic
1160257586 18:77260289-77260311 CTCTGCGCCCTCTTTCATAAGGG + Intronic
1161347848 19:3777018-3777040 CACTTCTGCTTCTTTCATGATGG - Intergenic
1161417631 19:4156578-4156600 CACTGCAGCCTCCGTCTTACGGG + Intronic
1162764792 19:12912331-12912353 CCTTCCTGCCTCCTTCATAATGG + Intronic
1165007805 19:32820750-32820772 CACTGCTGCCCACTTCAAACAGG - Intronic
1166058118 19:40306073-40306095 CACTGCAACCTCCTTCATCTGGG - Intergenic
1166092538 19:40519616-40519638 CAGGGCTGCCTCCTCCAGAAGGG - Exonic
1167735232 19:51290491-51290513 CACTGCTGACACCTTGATCATGG - Intergenic
1168216097 19:54927012-54927034 CACTGCAGCCTCCTTCTCACAGG - Intronic
925009500 2:471473-471495 CACTGCTGCCTCCATGTGAAGGG - Intergenic
925213619 2:2073045-2073067 CTCTGGGGCCTCTTTCATAAGGG + Intronic
926560077 2:14407107-14407129 AATTGTTGCCTCCTTGATAATGG - Intergenic
927650268 2:24908785-24908807 CACTGCTTCCTGCTTCCTAATGG + Intronic
928273636 2:29879361-29879383 CACTGCTTCCTCCATCAAAAAGG + Intronic
929039590 2:37730934-37730956 AATTTCAGCCTCCTTCATAATGG - Intronic
929633193 2:43487696-43487718 CACTGGGGCCTCTTTTATAAGGG - Intronic
931013147 2:57942353-57942375 CACAACTGCCTGATTCATAATGG - Intronic
932579265 2:72983023-72983045 CACTGCTGCCTCCTGCTCACAGG + Intronic
932590067 2:73059897-73059919 CACTGCTGCATTCTTTACAAAGG + Intronic
932749294 2:74361262-74361284 AACTGCTCCCTCCTTCCTGAGGG - Exonic
932970824 2:76538863-76538885 CTCTCATGCCTCTTTCATAAGGG - Intergenic
934512021 2:94953097-94953119 CACAGCTGCCTCCTTCCTCGAGG + Intergenic
934904580 2:98187490-98187512 CAGTCCTGCCTCCTCCAGAATGG + Intronic
935131773 2:100265950-100265972 CCATGCTGCGTCCTTCACAATGG + Intergenic
935179593 2:100677600-100677622 CACTGCGGCCTCTTTTATAAGGG + Intergenic
935279681 2:101506568-101506590 CACATCTGCCTCCCTCATAAGGG - Intergenic
935443673 2:103133447-103133469 CACTGCTGACACCTTATTAATGG + Intergenic
936772250 2:115927892-115927914 CTCTGCTGCATCCTTCAGAAGGG - Intergenic
936950849 2:117975949-117975971 AACTGCTGCCTCCTCAATCATGG + Intronic
938609190 2:132929590-132929612 CACAGCTGCCTTCTTCATCTAGG + Intronic
939010891 2:136844684-136844706 CACTGCTGCTTCCTTCCTGAAGG - Intronic
939036919 2:137143405-137143427 CCCTGCTGCCTGCTTCCTCAAGG - Intronic
939555632 2:143669644-143669666 CTCTGGGGCCTCTTTCATAAAGG + Intronic
944286270 2:197953281-197953303 CAGTGCTGCTTCCTTCAAACTGG + Intronic
944641107 2:201726779-201726801 CACTGCTACCACTTCCATAAGGG + Exonic
945636018 2:212352151-212352173 CACTGGGGCCTCCTTGAAAATGG + Intronic
946481462 2:220060714-220060736 CCCTGGAGCCTCCTTTATAAGGG - Intergenic
947319402 2:228899113-228899135 CCCAGCTGCCACCTTGATAAAGG + Intronic
1168844785 20:936568-936590 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
1169086758 20:2830922-2830944 CACTGCAGCCTCCATCATCCGGG + Intergenic
1169884376 20:10382253-10382275 CTTTTCTGCCTCCCTCATAAGGG - Intergenic
1170443917 20:16405536-16405558 CATTTCTGTCTCCTTTATAAGGG - Intronic
1170794209 20:19532351-19532373 CACTGCTCCCTCATCCACAAGGG + Intronic
1170900115 20:20454408-20454430 CACTGCTGCCTGCTCCTTATAGG + Intronic
1171166235 20:22974494-22974516 CACTGCAGCCTGCTTCCAAATGG - Intergenic
1171445349 20:25198921-25198943 CACTGCTGCCTCCTGCCAAATGG + Intronic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172168405 20:32913343-32913365 CTCTGGGGCCTCCTTTATAAGGG + Intronic
1173141865 20:40491722-40491744 CATTGATGGCTCCTTCATAATGG + Intergenic
1173189985 20:40868800-40868822 CACTGCTCCAGCCTTCATATAGG - Intergenic
1174602264 20:51734282-51734304 CCCTCCTGCCTCTTTTATAAGGG + Intronic
1174650414 20:52120073-52120095 CTCTGATGCCTCTTTTATAAGGG - Intronic
1174884682 20:54320234-54320256 AACTGCTGCCTCCTGGAGAATGG + Intergenic
1175362830 20:58427494-58427516 CACTTTTGCCTGCATCATAATGG - Intronic
1175362833 20:58427570-58427592 CACTTTTGCCTGCATCATAATGG - Intronic
1175362837 20:58427646-58427668 CACTTCTGCCTGCATCATAATGG - Intronic
1175362840 20:58427715-58427737 CACTTCTGCCTGCATCATAATGG - Intronic
1175616893 20:60407313-60407335 CACTGCTGCCTGCCTCTCAAGGG + Intergenic
1175756527 20:61533656-61533678 CACTGCCGCCTCCTGCTTCATGG + Intronic
1176308385 21:5136296-5136318 CATTGCTGCCACCATCACAAAGG + Intronic
1179848675 21:44125736-44125758 CATTGCTGCCACCATCACAAAGG - Intronic
1180255584 21:46625123-46625145 CACTGCAGCCTCCTTCTCTAGGG + Intergenic
1180624093 22:17182408-17182430 CACTGCTGCCTCATTCTTATTGG + Intronic
1181483120 22:23213521-23213543 GCCTGCTGCCTCCTTCTTAGTGG - Intronic
1182256457 22:29042593-29042615 CACTGCAGCCTCCCTGAGAAAGG + Intronic
1182693831 22:32182916-32182938 CCCTCAAGCCTCCTTCATAAGGG + Intergenic
1183904168 22:41027568-41027590 AACTGCTGTCTCCTCCATGATGG - Intergenic
1183948221 22:41338721-41338743 CACTGCTGCCTCCTTCTTCTGGG - Intronic
1184636963 22:45840465-45840487 CACTGCTGCTTCCTTTCTCATGG - Intronic
1184880559 22:47301855-47301877 CACTGCTGCCCACTGCAGAAGGG - Intergenic
1185076912 22:48688157-48688179 CACTGGCGCACCCTTCATAAAGG + Intronic
949264481 3:2140560-2140582 CTCTGCAGCCTCTTTTATAAGGG + Intronic
949848503 3:8397302-8397324 CCCTGCTGCCTCATTCAATATGG - Intergenic
950005435 3:9688281-9688303 CACTGCAGCCCCCTACAAAAGGG + Intronic
950688881 3:14639831-14639853 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
951448357 3:22808350-22808372 CATAGCAGCCTCATTCATAATGG + Intergenic
951609656 3:24478490-24478512 CACTTCTGCCTCCTTTTTAAAGG - Intronic
952748259 3:36802486-36802508 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
952971989 3:38657129-38657151 GAGTTCTGCCACCTTCATAAAGG + Intergenic
953504147 3:43467301-43467323 CACTGCTGCCTCATTCATAACGG + Intronic
954453508 3:50584505-50584527 CACTCCTGCCTCCTTTACAGAGG - Exonic
954874107 3:53789892-53789914 CAATGCTGCCTCCCACATGAAGG + Intronic
956244817 3:67171104-67171126 AAATGCTGCCTCCCTCATTAGGG + Intergenic
956559912 3:70564426-70564448 TCCTGCTGCCACCTTCATTAGGG - Intergenic
957510271 3:81179261-81179283 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
958797437 3:98720721-98720743 CTCTGATGCCTCTTTGATAAGGG - Intergenic
960054685 3:113268680-113268702 CACTGCAGCCTCCATCACCAAGG + Intronic
961669208 3:128516867-128516889 CACTTCTGCCTCCCTCTTATGGG - Intergenic
963842551 3:150122434-150122456 CACTCCAGACTCTTTCATAAGGG - Intergenic
963916683 3:150865172-150865194 CACTGCTGTCTCCATGATACAGG - Intergenic
965529911 3:169761007-169761029 GATTGCTGCCTCCTTAAAAAGGG + Intergenic
966843618 3:184108758-184108780 CACTGCAGCCTCCTGCACAGTGG - Intergenic
967825814 3:193876631-193876653 CTCTGGTGTCTCCTTAATAAGGG + Intergenic
967862472 3:194162276-194162298 CTATGCTGCCTCCTTCTTTACGG - Intergenic
968864124 4:3196883-3196905 CCCTCCTGCTTCCTTCATGAGGG + Intronic
969528831 4:7718316-7718338 CCCTGCTGCCTCCTTCAGTCTGG - Intronic
970488466 4:16547672-16547694 CACTGCTGCCTCTATAATTAGGG - Intronic
970713133 4:18887740-18887762 CTGTGCAGCCTCCTTTATAAGGG - Intergenic
971108866 4:23559899-23559921 CAGTGCTGCCACCTGCATCATGG + Intergenic
971441140 4:26687290-26687312 TACCACTGCCTCCTTCAGAAAGG - Intronic
971607957 4:28683534-28683556 CACTGCTGCCTCATGAAAAATGG + Intergenic
971822768 4:31580205-31580227 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
972084882 4:35204363-35204385 CACTGTCCCCACCTTCATAAGGG - Intergenic
973157358 4:46973325-46973347 CACTGGGGCCTCTTTTATAAAGG - Intronic
974431388 4:61801222-61801244 CATTGCTTCCACCTTCATGATGG - Intronic
975516257 4:75251578-75251600 CACTGCTGCCAGCCTCAGAATGG + Intergenic
975648581 4:76569381-76569403 AACTGCTGCCTGCTTTATGAAGG + Intronic
979051821 4:115944602-115944624 AAATGCTGCCTCTTCCATAATGG - Intergenic
979828549 4:125270931-125270953 CACTGGTGACTGCTTCAGAAAGG - Intergenic
980792303 4:137635162-137635184 CATTGCTCCATCCTTCAAAATGG - Intergenic
982058919 4:151583280-151583302 CTCTGCTATCTCCTTCAGAATGG - Intronic
982121626 4:152148701-152148723 CCCTCCTGCCACCTTGATAAGGG + Intergenic
983813778 4:172097426-172097448 GACTCCTGCCTTCCTCATAATGG - Intronic
983836357 4:172391504-172391526 CTCAGAAGCCTCCTTCATAAGGG + Intronic
984045723 4:174796152-174796174 CTCTGGGGCCTCTTTCATAAAGG - Intronic
984478260 4:180265010-180265032 CTCTGCTGACTCCATCATAATGG - Intergenic
984867976 4:184299411-184299433 CCCTGGTGCCTCATTCATCACGG + Intergenic
985947760 5:3200211-3200233 TACTGCTGCTTCCTTCTCAATGG + Intergenic
986014902 5:3749092-3749114 CCCTGGTGCCTCCTTCACCAGGG + Intergenic
986861884 5:11936291-11936313 CTCTGGGGTCTCCTTCATAAGGG + Intergenic
987838815 5:23196712-23196734 CTCTGGTGCCTCTTTAATAAGGG - Intergenic
988716667 5:33835608-33835630 CGCTGCGGCCTCTTTTATAAAGG + Intronic
992501065 5:77344578-77344600 CACTGGAGCCTCTTTAATAAAGG + Intronic
993252516 5:85547897-85547919 CAGTGCTGGCTCCATCGTAATGG + Intergenic
993419699 5:87685355-87685377 CTCTGGGGCCTCTTTCATAAGGG + Intergenic
994327330 5:98463639-98463661 CCCTTCAGCCTCCTTTATAATGG - Intergenic
995568096 5:113452442-113452464 CTCTGGGGCCTCCTTTATAAGGG - Intronic
995990093 5:118227892-118227914 CACTGGGGCCTACTTCAGAATGG + Intergenic
999862831 5:155666895-155666917 CACTGGTCCCTCTTTCCTAAGGG + Intergenic
1000019912 5:157310014-157310036 CTCTGCTGCCAGCTTCAAAAGGG + Intronic
1001588276 5:172848238-172848260 CACTGTTTCCACCTTCATGATGG + Intronic
1001621675 5:173091283-173091305 CACTGCCGAATCCTTCATCATGG - Exonic
1003120054 6:3311999-3312021 CACTGTTGCCTCCTTCCGGAAGG + Intronic
1004361428 6:14974558-14974580 CTCTGCTGCCTCCTCCATGTGGG - Intergenic
1005003283 6:21263902-21263924 CACTGCTGCCTCCTTGGCAACGG + Intergenic
1005701697 6:28407665-28407687 CACAGCTGCCTCCCTTATTAGGG - Intergenic
1006081806 6:31572243-31572265 CACTGCCGCTTCCTCTATAAAGG + Exonic
1006323980 6:33339191-33339213 CCCTGGTGCCTCATTCATTATGG - Intergenic
1006576815 6:35052700-35052722 AAGTGCTGCCTCCTTCAGCAGGG - Intronic
1008357300 6:50569778-50569800 CCCTGGGGCCTCTTTCATAAGGG - Intergenic
1009636946 6:66278881-66278903 CACTGGGGCCTCCTACTTAAGGG - Intergenic
1010473655 6:76261082-76261104 CATTGCTGCATCCTTCAGAGAGG - Intergenic
1011872714 6:91916617-91916639 CACTGCAGCCTACTTCATGTGGG + Intergenic
1014341718 6:120216648-120216670 CCTTGCTTCCTGCTTCATAAAGG - Intergenic
1014381084 6:120743264-120743286 CTCTGGGGCCTCTTTCATAAAGG - Intergenic
1014578939 6:123110118-123110140 CACTGCTGCCTTATTCAAAGTGG - Intergenic
1014998739 6:128188496-128188518 CAATCCTACCTCCTTCCTAAGGG + Intronic
1016129586 6:140449951-140449973 CTCTGCAGCCTCTTTTATAAGGG - Intergenic
1016536589 6:145113320-145113342 CTCTGAGGCCTCCTTTATAAGGG - Intergenic
1016549159 6:145257683-145257705 CACTGCAGCTACCTTCATAGAGG - Intergenic
1017052027 6:150402242-150402264 CATGGCTGCCTCCTTCCTAGAGG + Exonic
1020180896 7:5921736-5921758 CACTTTTGCCTCCTTCACAAAGG - Intronic
1020302037 7:6803152-6803174 CACTTTTGCCTCCTTCACAAAGG + Intronic
1020366579 7:7387003-7387025 CCCTGGGGCCTCCTTTATAAGGG + Intronic
1021961267 7:25875376-25875398 CTCTGCTGACTCCTTCATTCTGG - Intergenic
1022016114 7:26349943-26349965 GCCTGCTCCCTCCTCCATAAGGG + Intronic
1022156992 7:27670639-27670661 CACTGCTTCCTCAATCACAAAGG - Intergenic
1023558475 7:41447813-41447835 CCATGCAGCCTGCTTCATAAAGG - Intergenic
1026270432 7:68831740-68831762 CTGTGCTGCCTGCTTCCTAATGG + Intergenic
1028163368 7:87510553-87510575 CACTGGTGCCTTCTTCAGAAGGG - Intronic
1028543596 7:91972917-91972939 CACTGCAGCCTTATTCATAATGG - Intronic
1028600456 7:92595027-92595049 CATTGCTGGATACTTCATAATGG + Intergenic
1028636254 7:92992927-92992949 ACCTGCGGCCTCCTTCATTATGG - Intergenic
1028636400 7:92994278-92994300 CCCTGGGGCCTCCTTTATAAGGG - Intergenic
1028721269 7:94034708-94034730 CTCTGCAGTCTCTTTCATAATGG - Intergenic
1030184816 7:106751076-106751098 CACTGGTTCTTCCTTCATCAAGG + Intergenic
1030786999 7:113674673-113674695 AACAGCTGCCTCCTTAAAAATGG - Intergenic
1032383872 7:131508177-131508199 CACTGCTACCTCCCTCACACAGG + Intronic
1032982630 7:137301371-137301393 CACAGCTGTCTCCTTCCTGATGG - Intronic
1035341017 7:158161986-158162008 CTCTGCTTCCTCCATCATCAGGG + Intronic
1036161491 8:6393011-6393033 CCCTGGGGCCTCCTTTATAAGGG - Intergenic
1037002029 8:13731711-13731733 CCCTGCTGCCTCTTTTATAAGGG - Intergenic
1037555591 8:20018997-20019019 CTCTGGGGCCTCTTTCATAAGGG - Intergenic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1039010236 8:33085787-33085809 CACTGGTGTCTCATTGATAATGG + Intergenic
1039237496 8:35517925-35517947 CACAGGTGCCCCTTTCATAAGGG + Intronic
1039780040 8:40776007-40776029 CCCTGCTGCCACCTTGATCATGG + Intronic
1041931387 8:63291294-63291316 CTCTGGGGCCTCCTTTATAAGGG + Intergenic
1042365963 8:67936671-67936693 CCCTCATGCCTCTTTCATAAGGG + Intergenic
1042721853 8:71834632-71834654 CACTTCTGCCTCCTTTCTATTGG + Intronic
1042879664 8:73473067-73473089 CACTTCTTCCTCCTTCATGCTGG - Intronic
1044357626 8:91242596-91242618 CTCTGGTGCTTCCTTTATAAGGG - Intronic
1045387974 8:101689577-101689599 CACTGCTGCCTCATTCACCATGG + Intronic
1045801317 8:106104623-106104645 AACTGCTGACTCATTCATCAGGG + Intergenic
1046859301 8:119072075-119072097 CACTGCTGCCTCCTTCACTAAGG + Intronic
1047222709 8:122931273-122931295 CACTGCTGCCTGCGTGAGAAGGG + Intronic
1047576243 8:126158846-126158868 CACTGCTGGCTACTTTAGAAGGG - Intergenic
1049274706 8:141714348-141714370 CACTGCTGACTGTGTCATAATGG - Intergenic
1051108191 9:13604423-13604445 CACTGCTGCAACCATCATATTGG + Intergenic
1051370630 9:16356005-16356027 CCCTGCTTCCTCCTTCACCATGG - Intergenic
1052911797 9:33889504-33889526 CTCTCTTGCCTCTTTCATAAGGG + Intronic
1053018216 9:34676149-34676171 GACTTCAGCCTCCTTCCTAAGGG - Intergenic
1055162337 9:73145555-73145577 CACTGCTAACTCCCTGATAATGG - Intergenic
1055480053 9:76700769-76700791 TCCTGCTGCCTGCTCCATAAAGG + Intronic
1055599117 9:77897087-77897109 CACGGGTGCCTCCTTTGTAATGG - Intronic
1055667319 9:78565726-78565748 AACAGCTGCCTCCTTCAGACAGG - Intergenic
1055933044 9:81579605-81579627 GACTGCTGCCTCTGTCATCATGG - Intergenic
1057165374 9:92921294-92921316 CACAGCTGCCTCCTTCCTTAGGG - Intergenic
1059888293 9:118771240-118771262 CACTGGTGCCTCTTTCCAAAAGG + Intergenic
1060207050 9:121688288-121688310 CACTGCTGCCACCTCCACAGAGG - Intronic
1060239507 9:121890718-121890740 CACTGCTGACTCCTCCATCCTGG + Intronic
1060744517 9:126122434-126122456 CACTGCAACCTTATTCATAATGG - Intergenic
1060794567 9:126505089-126505111 CACTTCTGCCCACTTCATTAGGG + Exonic
1061958532 9:133976300-133976322 CACTGTCGCCTCCTCCATCAGGG - Intronic
1186258661 X:7751374-7751396 CTCTGCGGCCTCTTTTATAAGGG - Intergenic
1186848757 X:13558317-13558339 CACTGCAGCCTCGATCATACAGG + Intergenic
1188614700 X:32143385-32143407 CAATACTGCCTGCTTCATGAGGG - Intronic
1189076071 X:37916106-37916128 AACTCCTGCCTCCTTCTCAAAGG + Intronic
1191241552 X:58194005-58194027 CACAGGTGTCTCCATCATAAGGG - Intergenic
1192174378 X:68876739-68876761 CACTGCTGCCTCTTAGAGAAGGG - Intergenic
1192996322 X:76516606-76516628 AACTGCTGCCCTTTTCATAATGG - Intergenic
1193451876 X:81680760-81680782 CACTTCTGCCTCCTAAATCATGG + Intergenic