ID: 1080662629

View in Genome Browser
Species Human (GRCh38)
Location 11:34310076-34310098
Sequence TCCTCCCCCTTTTAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080662629_1080662635 25 Left 1080662629 11:34310076-34310098 CCCTGCATCTAAAAGGGGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1080662635 11:34310124-34310146 TCAATGACAGGAGCTCAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 200
1080662629_1080662634 22 Left 1080662629 11:34310076-34310098 CCCTGCATCTAAAAGGGGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1080662634 11:34310121-34310143 TCATCAATGACAGGAGCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 112
1080662629_1080662633 21 Left 1080662629 11:34310076-34310098 CCCTGCATCTAAAAGGGGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1080662633 11:34310120-34310142 CTCATCAATGACAGGAGCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 148
1080662629_1080662631 13 Left 1080662629 11:34310076-34310098 CCCTGCATCTAAAAGGGGGAGGA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1080662631 11:34310112-34310134 GTCTCCTGCTCATCAATGACAGG 0: 1
1: 0
2: 0
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080662629 Original CRISPR TCCTCCCCCTTTTAGATGCA GGG (reversed) Intronic
900934931 1:5759120-5759142 TCCTCCTCCTTTTAGAGCCTGGG - Intergenic
901242105 1:7701420-7701442 TTCTCCCCCTTTTTGAGACAGGG + Intronic
905991783 1:42343667-42343689 TCCTCCTCATTTTATAGGCAAGG + Intergenic
907822637 1:57986138-57986160 TCCTCCCCCTTTTAGCTCCCAGG - Intronic
909881451 1:80884503-80884525 TTCTGACCCTTTTAAATGCAAGG - Intergenic
912602154 1:110946985-110947007 TCCTCCTCCTTTAAGAGACAGGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914771559 1:150690771-150690793 TCCTCCCATTTTTAAAGGCATGG + Intronic
916004028 1:160643143-160643165 TCCTCCCTCTTTTATAGGTAGGG - Intronic
918486555 1:185035014-185035036 TCTTCCCCCCATTAGATGCTGGG + Intergenic
919503132 1:198363412-198363434 TCCTTCTCCTTTGAGATACATGG + Intergenic
919747250 1:201016649-201016671 TGCTTGCCCTTTTAGCTGCAGGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922509042 1:226147547-226147569 TCCTCCCCATTTTAGAAAGATGG + Intronic
922946029 1:229514854-229514876 TCCTCCCCCTTGTGGCTGTAGGG + Intergenic
1063967700 10:11359663-11359685 GCCTCCCACTTGGAGATGCAGGG - Intergenic
1065022090 10:21509532-21509554 TCATTCCCCTTGCAGATGCACGG + Intergenic
1067397244 10:45933330-45933352 TCATCCTCCTTTTGCATGCAGGG + Intergenic
1067865567 10:49902431-49902453 TCATCCCCCTTTTGCATGCAGGG + Intronic
1070152531 10:73813688-73813710 CCCTCCCCCTCCTAGCTGCAGGG + Exonic
1072067287 10:91883513-91883535 TTCTCCCTCTTTTAGCAGCATGG - Intergenic
1074560147 10:114528446-114528468 TCCTCTTCATTTTAGAAGCACGG - Intronic
1080662629 11:34310076-34310098 TCCTCCCCCTTTTAGATGCAGGG - Intronic
1081471743 11:43380117-43380139 TCATCCTCATTTTAGAGGCAAGG + Intronic
1087128641 11:94650565-94650587 TCTTTCCCCTTTTACATACAGGG + Intergenic
1089686711 11:120154300-120154322 GCCTCCCTCTTTTAGGTACAAGG + Intronic
1091454234 12:593705-593727 TCCTCCTCCTTTTTGAGACAGGG - Intronic
1094470698 12:30798505-30798527 TCCTCCCACTTTCAGAAGAAAGG - Intergenic
1094585334 12:31772523-31772545 TCCTCCCTCTTTCAGTTGTAAGG + Intergenic
1096755464 12:53795954-53795976 TCCTCAGCCCTTGAGATGCAGGG - Intergenic
1097336185 12:58385921-58385943 TCTTTCCCCTTATAGAAGCAGGG - Intergenic
1098939755 12:76520369-76520391 GCCTCCCCCCATTAGATCCAAGG + Intronic
1106469285 13:30040211-30040233 TCCTCCCCCTTTTGTATGTAGGG - Intergenic
1110196719 13:72797528-72797550 TCTTCCCCCATATAAATGCATGG - Intronic
1110448725 13:75617634-75617656 TCCTCCCCTTTTTATAGGCAGGG + Intergenic
1112759085 13:102672721-102672743 TCCCCCTCCTCTTAGATGCCAGG - Intronic
1112901767 13:104365538-104365560 TCCTCATCCTTTTCTATGCATGG - Intergenic
1115805928 14:37051672-37051694 TTCTTGCCCTTTTAGATTCAGGG - Intronic
1118775430 14:68970927-68970949 TTATCCCCATTTTACATGCAGGG - Intronic
1119596124 14:75935721-75935743 TCCTCCCCTTTTTATATGAAGGG - Intronic
1119812100 14:77530652-77530674 ACCTCTCCCTTTTAGAAGCAAGG + Intronic
1122134274 14:99623882-99623904 TCATCCCCCTTCTAGAGACAAGG + Intergenic
1123159696 14:106266452-106266474 TCATCCCTTTTTCAGATGCATGG - Intergenic
1123796760 15:23780463-23780485 GCATCCTCCTCTTAGATGCATGG + Intergenic
1123901341 15:24880277-24880299 ACCCCCCTCTTTTAGAGGCAAGG - Intronic
1127519239 15:59726980-59727002 TTCTCCCCATTTTACAGGCAAGG - Intergenic
1128807886 15:70546824-70546846 TCCACCCCCTTATAGCTGTAAGG + Intergenic
1129293889 15:74588830-74588852 CCCTCCCCCTTTCAGAGGCCAGG + Intronic
1130705944 15:86233031-86233053 TGATCCCCATTTTACATGCAAGG + Intronic
1133781173 16:8940555-8940577 ACCTCTCCCTTTCTGATGCAGGG - Intronic
1136685398 16:31991220-31991242 TCCTGGCCCTCTTATATGCATGG + Intergenic
1136786012 16:32934750-32934772 TCCTGGCCCTCTTATATGCATGG + Intergenic
1136883763 16:33919053-33919075 TCCTGGCCCTCTTATATGCATGG - Intergenic
1138381505 16:56606065-56606087 TCATTCTCCTTTTAGCTGCAGGG - Intergenic
1142143438 16:88482804-88482826 TCCTCCCCCTTCTAGAGGCCCGG - Intronic
1203088245 16_KI270728v1_random:1196408-1196430 TCCTGGCCCTCTTATATGCATGG + Intergenic
1147146343 17:38486895-38486917 TCCTGGCCCTCTTATATGCATGG + Intronic
1149232485 17:54551721-54551743 TCCTTTCCCTTCTAGATGTAGGG + Intergenic
1150976932 17:70098097-70098119 TTCTCCCCATTTTAGATCCCAGG + Intronic
1151402762 17:73866680-73866702 TCCTCTCCCTTTGAGTTGCAAGG - Intergenic
1152236155 17:79139957-79139979 CCCTGCCCCTTTTACCTGCAGGG - Intronic
1153567961 18:6439205-6439227 TCCACCTCCTTTCAGAAGCATGG + Intergenic
1155500827 18:26485251-26485273 TTATCCCCATTTTAGAGGCAAGG + Intronic
1155916629 18:31564022-31564044 TTCTCCTCCTTATAGATACAAGG - Intergenic
1157466232 18:47948514-47948536 TACTCTCCCTTTTATAAGCACGG - Intergenic
1158369572 18:56784565-56784587 TCATCCCCATTTAAGATCCAAGG - Intronic
1158410165 18:57198553-57198575 TGCTCCACCATTTAGCTGCATGG + Intergenic
1159586128 18:70285299-70285321 TTTTTCCCCTTTTAGATGAAGGG + Intergenic
1159900948 18:74045091-74045113 GCCTCCCACGTGTAGATGCAGGG + Intergenic
1161870815 19:6868392-6868414 TCTGCCCCCTGTGAGATGCAAGG + Intergenic
1166170218 19:41023198-41023220 TCATACCCCTTTCAGAGGCAGGG - Intergenic
1166938919 19:46351250-46351272 CATTCCCCATTTTAGATGCAAGG - Intronic
1167837293 19:52084732-52084754 TCCTCCCTTTTTGAAATGCAGGG - Intronic
925623770 2:5821291-5821313 TCCTCCCTGTTTTAGAGGTAAGG - Intergenic
928271717 2:29861163-29861185 TCCTCCTTCTTTTTGAGGCAAGG - Intronic
928392149 2:30918355-30918377 TCATCCTCATTTTACATGCAAGG - Intronic
932008551 2:67952553-67952575 TCACCCTCATTTTAGATGCATGG + Intergenic
933270409 2:80226945-80226967 TCCTCCTGCTTATAGAAGCATGG + Intronic
941193581 2:162418265-162418287 TATACCCCCTTTTAAATGCATGG + Intronic
941493817 2:166175920-166175942 ACCTCCCACTTTTGGGTGCATGG + Intergenic
942357584 2:175135090-175135112 TCCTCCCCCTTCTCCATGCCTGG - Intronic
944276435 2:197843740-197843762 TCCTTCCCCTTTCAGATCTAGGG - Intronic
947144723 2:227054466-227054488 TCCTCCTCCTTTTAGTTCTATGG - Intronic
1171304870 20:24096518-24096540 TCCTGCCCCTTTTTAATCCAGGG - Intergenic
1173467027 20:43291348-43291370 TCCTGCCTCTTATAGATCCAGGG - Intergenic
1176362055 21:6006171-6006193 TCCTCCTCCTTTTGGAGACAGGG - Intergenic
1176516224 21:7785659-7785681 TCTTCTCCCTTCTAGATGCTGGG + Intergenic
1177072185 21:16524344-16524366 TCCTCACCCTTTTCCATGTAAGG - Intergenic
1178650252 21:34415671-34415693 TCTTCTCCCTTCTAGATGCTGGG + Intergenic
1179603294 21:42495712-42495734 TCCCCCGGCATTTAGATGCATGG - Intronic
1179761463 21:43532374-43532396 TCCTCCTCCTTTTGGAGACAGGG + Intronic
1182380699 22:29884432-29884454 ACCTTCCCCTTTCAGATTCAGGG + Intronic
1183745587 22:39689819-39689841 TCCTCCCCCATTTTCAGGCATGG + Intergenic
1184903240 22:47460955-47460977 TCCTCCTCCTTGTGGCTGCATGG + Intergenic
949715082 3:6920733-6920755 TCCTTCTCCTTTTGGATGCCTGG + Intronic
949910013 3:8895845-8895867 TCCTCCCCCTTTTAGAAAAGAGG + Intronic
950269040 3:11598494-11598516 TCCTTCCTTTTTTAGAGGCAGGG + Intronic
950609490 3:14116879-14116901 TCCTCAGCCTTTCAGAGGCAGGG - Intronic
952131734 3:30371918-30371940 TCTTCCCCCTTTGGGATGCATGG + Intergenic
953477951 3:43221840-43221862 ACCTCCCTCCTTTAGATGTAAGG - Intergenic
953643525 3:44731411-44731433 TCCTACACCTTCTAGATTCAGGG - Intronic
954637419 3:52078831-52078853 TCCTTCCCCTTGTAGAGGGAAGG - Intronic
960205895 3:114897521-114897543 TCCTCCCTCTTTGAGATTCCAGG + Intronic
961243026 3:125428823-125428845 TCTTCCCTCTGTTACATGCATGG + Intergenic
961464594 3:127073462-127073484 TCCTCCTCCTGAAAGATGCATGG + Intergenic
962007339 3:131361807-131361829 TCCTCCCCCTTATCCCTGCAGGG + Intergenic
965499252 3:169438052-169438074 TCATCCCCATTTTATATGTAAGG + Intronic
966382896 3:179361311-179361333 TCCTCCTTATTTTAGATTCAGGG + Intronic
969241386 4:5900754-5900776 TCCTCCCCATTTTACAGGCGAGG - Intronic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
971942827 4:33237668-33237690 TCTTCCCCTTTTTGAATGCAGGG - Intergenic
975069985 4:70122575-70122597 TTCTGCAGCTTTTAGATGCATGG - Intergenic
975154116 4:71052363-71052385 TCCTCCCTGTTTTAGAAGCTGGG + Intergenic
976515336 4:85957910-85957932 TACTCCCAATTCTAGATGCATGG - Intronic
978458666 4:108925411-108925433 TCTTCCCCCTTCTATATGCATGG - Intronic
982114561 4:152086965-152086987 TCTTCCCCCTTCCAGGTGCATGG - Intergenic
984128941 4:175849244-175849266 CCAGCCCCCTTTTAGTTGCATGG + Intronic
985145073 4:186888137-186888159 TCCTCCACCTCTAAGATGCGTGG - Intergenic
985921964 5:2984396-2984418 GCCTGCCCCTTTAAGAGGCACGG - Intergenic
994370785 5:98964703-98964725 TCCTCCCCTTTTGGGAGGCAAGG - Intergenic
995540873 5:113184976-113184998 TCCTCCACCTTTTAACTGAAAGG + Intronic
996522211 5:124439597-124439619 TCCTCTCCATTGTAGATGCCTGG - Intergenic
998659333 5:144219080-144219102 TCATCCCCCTTTTATGTGGAGGG - Intronic
998847954 5:146329165-146329187 TTTTCCCCCTGATAGATGCATGG - Intronic
999312186 5:150558602-150558624 TCCCTCACCTTTTAGACGCATGG + Intergenic
999473182 5:151874378-151874400 ACCTCCCAATTTTAGATTCAAGG - Intronic
1000040456 5:157481074-157481096 TCCTCCCGATTTTAGAAGGAAGG + Intronic
1001492383 5:172164998-172165020 TCCTCCCCCTTGTACCCGCAAGG + Intronic
1003195659 6:3911974-3911996 TCCTCTCCCTGCTAGGTGCAAGG + Intergenic
1004225132 6:13778044-13778066 TCCTGCCCCTTTTAAAGGGAAGG - Intergenic
1004225189 6:13778524-13778546 TCCTGCCCCTTTTAAAGGGAGGG + Intergenic
1004236129 6:13875737-13875759 TCTTCCAACTTTTGGATGCAAGG - Intergenic
1010292207 6:74150599-74150621 TTCGCCCACTTTTTGATGCAAGG - Intergenic
1012201934 6:96417270-96417292 TTCTCTCCCTTTTAAATCCATGG + Intergenic
1015517043 6:134093099-134093121 TCCTACCACTTTCAGAGGCATGG + Intergenic
1018563408 6:165125828-165125850 TCCTCCCACTCTTACATTCACGG + Intergenic
1018647877 6:165964890-165964912 TCCTCCTCCTTTAACAAGCACGG - Intronic
1018942970 6:168321952-168321974 TCCTCCTCCTTTTTGAGACAGGG + Intergenic
1019325382 7:435859-435881 TCTTCCCCCTTCTACAGGCAAGG - Intergenic
1019398971 7:840248-840270 GCCTCACCCTTGGAGATGCAGGG + Intronic
1021783391 7:24129152-24129174 TCCTCTCTCTTTTAGGTCCATGG + Intergenic
1026159175 7:67853558-67853580 TCCTCCCGCATTTTGATGCTGGG - Intergenic
1029799701 7:102933627-102933649 TCCTTCCCCTCTTAGTTGCCTGG - Intronic
1032095364 7:128935492-128935514 TCATCCCCCTTTTAGAGACGAGG + Intergenic
1036154277 8:6327345-6327367 TCCTCGCCCTTGCAGATGGAAGG - Intergenic
1039908760 8:41807815-41807837 GGCTCCCCCTTGTAGATGCTTGG - Intronic
1040743085 8:50604522-50604544 CCCTCCCCTTTTTACAGGCAGGG + Intronic
1041468986 8:58187720-58187742 TCCTCCCATTTTTAGCTGGAAGG - Intronic
1042763679 8:72297768-72297790 TCCTCCTCCAGTTAGAAGCATGG + Intergenic
1045873099 8:106947959-106947981 TTCTCAAACTTTTAGATGCAAGG + Intergenic
1046048588 8:108993012-108993034 TCCTCCTCCTCTTAGTTGGATGG - Intergenic
1047596465 8:126382605-126382627 TTCTCTCCTTTCTAGATGCAGGG - Intergenic
1050438491 9:5634614-5634636 TTAGCCCCCTTTTAGATGTATGG + Intronic
1055680726 9:78712405-78712427 TTCTCCCCCTTTTAAATGTGAGG + Intergenic
1055925833 9:81508957-81508979 TCCTCCCCCTTTCATTTTCAAGG - Intergenic
1058470175 9:105269673-105269695 TCTTCCCCCTTTTAAAACCAGGG + Intronic
1058480262 9:105385927-105385949 TACTCCCCCTTTTAAAAGTATGG + Intronic
1059018497 9:110547568-110547590 TTCTCACCCTTTTTGATACAGGG - Intronic
1060096368 9:120793855-120793877 TCCTCCTCCTAATAGATGTAAGG - Intergenic
1060468301 9:123927567-123927589 TCCTCCCCATTTTACCTTCAGGG + Intronic
1061823308 9:133240550-133240572 TCCTCTCCATTTTACAGGCAAGG + Intergenic
1062019379 9:134309280-134309302 TCCTCCCCATTTTACAGCCAAGG + Intergenic
1062200655 9:135300990-135301012 TCCTCCTCCTTCGAGACGCAGGG - Intergenic
1203779868 EBV:95382-95404 TCGTCCCCCTTTTTGCTGGACGG - Intergenic
1187526409 X:20059050-20059072 TCATCCCCATTTTATAGGCAAGG - Intronic
1190335199 X:49257870-49257892 TCATCCCCCTTTTACACGTATGG + Intronic
1192767396 X:74155884-74155906 TCCTCTCCTTTTCAGAAGCATGG - Intergenic
1198524209 X:137483948-137483970 CCCTCTCCCCTTTAGTTGCAGGG - Intergenic
1199348682 X:146774003-146774025 TCATCCCCCTTTTTGGTGAATGG + Intergenic
1199750844 X:150816071-150816093 CCCTCTCCCTTTTAGAGCCATGG - Exonic
1199996487 X:153029717-153029739 TCCTCTCCCTTTCCGACGCATGG - Intergenic