ID: 1080663394

View in Genome Browser
Species Human (GRCh38)
Location 11:34315263-34315285
Sequence ACCAGGGCACTGAGGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080663387_1080663394 10 Left 1080663387 11:34315230-34315252 CCAAATTACCACAGAGCAAGTCT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1080663386_1080663394 11 Left 1080663386 11:34315229-34315251 CCCAAATTACCACAGAGCAAGTC 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1080663384_1080663394 26 Left 1080663384 11:34315214-34315236 CCTTGGTCGAGGAGCCCCAAATT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1080663383_1080663394 27 Left 1080663383 11:34315213-34315235 CCCTTGGTCGAGGAGCCCCAAAT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1080663385_1080663394 12 Left 1080663385 11:34315228-34315250 CCCCAAATTACCACAGAGCAAGT 0: 1
1: 0
2: 0
3: 19
4: 159
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1080663388_1080663394 2 Left 1080663388 11:34315238-34315260 CCACAGAGCAAGTCTCCTGATTA 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG 0: 1
1: 0
2: 0
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080663394 Original CRISPR ACCAGGGCACTGAGGTTCCT GGG Intronic
900523796 1:3118859-3118881 ACTTGGGCACAGAGGTGCCTCGG - Intronic
901173355 1:7280176-7280198 ACCTGGGCACTGAGGCACCAAGG + Intronic
902295377 1:15463381-15463403 AGCAGGGCAATGTCGTTCCTGGG - Exonic
902298269 1:15483259-15483281 AGCAGGGCAATGTCGTTCCTGGG - Exonic
903491793 1:23734583-23734605 ACCAGGGGACAGAGGTTGCAGGG - Intergenic
904410817 1:30323827-30323849 AGCAGTGAGCTGAGGTTCCTGGG - Intergenic
909337885 1:74497189-74497211 ACCATGACACTGATGTTCCTAGG + Intronic
916572690 1:166041164-166041186 AACAGGGAGCTGAGGTGCCTTGG + Intergenic
918277753 1:182970148-182970170 CCCAGGGAACTGAGTTTTCTGGG - Intergenic
919272929 1:195374148-195374170 ACTAGAGCAGTGAGGTTCCCTGG + Intergenic
923858852 1:237872648-237872670 ACTAGTGCCCTCAGGTTCCTGGG + Intergenic
924386931 1:243507731-243507753 ATCAGGCAACTGATGTTCCTTGG - Intronic
924586582 1:245366108-245366130 ACCACTGCACTGAGGTCCCTTGG - Intronic
1062873471 10:927116-927138 ACCAGGGCAATGGGGTTGATGGG + Intronic
1065783447 10:29191593-29191615 ACCACATCACTGAGGGTCCTGGG - Intergenic
1067374048 10:45711078-45711100 ACCTGGGCACTGGGGCCCCTGGG - Intergenic
1067379640 10:45761184-45761206 ACCTGGGCACTGGGGCCCCTGGG + Intronic
1067881877 10:50052834-50052856 ACCTGGGCACTGGGGCCCCTGGG - Intergenic
1067887338 10:50101841-50101863 ACCTGGGCACTGGGGCCCCTGGG + Intronic
1068844562 10:61657396-61657418 ACGAGGACACTGAGGTTCAGAGG - Intergenic
1068955053 10:62814326-62814348 ACCAGGGTACTGAGGGTCAATGG + Exonic
1070790650 10:79187376-79187398 AGCTGGGCAGTGAGGTTGCTGGG - Intronic
1072902519 10:99421171-99421193 ACTAGTGCACTGAGGTCTCTAGG + Intronic
1074183392 10:111082079-111082101 ATCTGGGCACTGAGGGGCCTGGG + Intergenic
1075234259 10:120712151-120712173 ACCTGGGCAGTGAGCTTGCTTGG + Intergenic
1076595044 10:131620121-131620143 ACCTAGGCAATGAGTTTCCTCGG + Intergenic
1077142894 11:1032191-1032213 ACCATAGCACTCAGGTTCATCGG - Intronic
1078415656 11:11162650-11162672 ACAGGGTCACTGAGGGTCCTGGG + Intergenic
1078463778 11:11535227-11535249 ACCAGGGCACTCTGGTACCATGG + Intronic
1079931750 11:26572224-26572246 AGCAGGTCAGTCAGGTTCCTGGG - Intronic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1081645621 11:44788186-44788208 ATCTGGGGACTGAGGGTCCTGGG - Intronic
1082793756 11:57365395-57365417 GCCAGGGCACTGAGGTGGCTGGG - Intronic
1083431079 11:62613712-62613734 ACAAGGACACAGAGGTGCCTGGG + Exonic
1083641487 11:64148145-64148167 AGCAGGGCCCTGGGGATCCTTGG - Intronic
1084551247 11:69843459-69843481 GCCAGGGCTCTGACGTTCCCAGG + Intergenic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1085126703 11:74006987-74007009 ACCATGGCTGTGAAGTTCCTGGG - Exonic
1085302009 11:75464196-75464218 GACAGGGATCTGAGGTTCCTGGG - Intronic
1087607660 11:100395876-100395898 CCTAGGGAACTGAGGTACCTAGG - Intergenic
1088782331 11:113148152-113148174 ACCAGGGCTCTGTCGTCCCTAGG - Intronic
1089633186 11:119796181-119796203 ACCAGGGCAGTGAGGCACCAAGG + Intergenic
1091296239 11:134475783-134475805 TCCTGAGCACTGAGGGTCCTAGG - Intergenic
1091946407 12:4548509-4548531 CCCAGGGCACTGATGTACCATGG + Intronic
1094281246 12:28741027-28741049 ACTAACGCACTGAGGTTTCTGGG + Intergenic
1096583851 12:52606650-52606672 AACAGGTCCCTGTGGTTCCTGGG - Intergenic
1098760795 12:74422843-74422865 ACCAGTGCACTCTGGATCCTGGG - Intergenic
1103840078 12:123855827-123855849 ACCAGGACACTCAGCCTCCTAGG + Intronic
1112898020 13:104324906-104324928 ACCAGGGCACTCTGGCACCTTGG + Intergenic
1113338607 13:109400554-109400576 ACCAAGGCACAGAGATTCCAGGG - Intergenic
1113720811 13:112554583-112554605 CCCAGGGGACAGAGGTCCCTTGG - Intronic
1116974062 14:51095900-51095922 ACCACGGCACTGAGGCCTCTGGG - Exonic
1117285404 14:54282052-54282074 TCCGGGGCTCTGTGGTTCCTGGG - Intergenic
1119296890 14:73539787-73539809 GCCGGGGCACTGGGGTTTCTCGG + Intronic
1119301125 14:73571701-73571723 GCCGGGGCACTGGGGTTTCTCGG + Intronic
1119688640 14:76653313-76653335 ACAAGGGCTCAGAGGTTCCCAGG - Intergenic
1119828749 14:77681826-77681848 ACCTAGGCACTGAGTTTCTTTGG + Intronic
1122231161 14:100306820-100306842 ACTAGGGCGCTGAGGTTCTGCGG - Intergenic
1125385685 15:39134080-39134102 ACCCAGTCACTCAGGTTCCTTGG + Intergenic
1125444527 15:39739068-39739090 ACAAGGGCGCAGGGGTTCCTGGG - Intronic
1125728047 15:41878105-41878127 CCCAGGACACTGAGCTGCCTGGG - Intronic
1126338620 15:47614829-47614851 ATGAGGGCACTGAGGCTCCAAGG - Intronic
1126438222 15:48657962-48657984 TCCAGGGAACTCAGGTTGCTCGG + Intergenic
1126919430 15:53504477-53504499 AACACGGGGCTGAGGTTCCTGGG + Intergenic
1128381460 15:67116210-67116232 ACCAGCGCACTGTGGTTGATGGG + Intronic
1129265438 15:74390864-74390886 ACCAGGTCACAGAGGCTTCTTGG + Intergenic
1129454181 15:75667652-75667674 ACCTGGGCAGTCAGGTTCTTTGG + Intergenic
1129858831 15:78844396-78844418 ACCAGGGCCCTGAACATCCTGGG - Intronic
1130106478 15:80932302-80932324 ACGTGTGGACTGAGGTTCCTAGG + Intronic
1130697161 15:86142131-86142153 CCCAGGTCACAGAGGTGCCTGGG - Intronic
1131130363 15:89895416-89895438 ATCAGGGCAGTGTGGTTCCAGGG - Exonic
1133725693 16:8535384-8535406 ACCAGGGTACAGAGCTTCATCGG + Intergenic
1133921180 16:10154520-10154542 TTCAGGGCACTGAGGATGCTGGG - Intronic
1135500504 16:22991811-22991833 ACCAGGGCACTGCATGTCCTTGG + Intergenic
1137838189 16:51614727-51614749 ATCTGAACACTGAGGTTCCTAGG - Intergenic
1139593866 16:67947287-67947309 GCCAGGGCGCAGAGGTTCTTAGG - Intronic
1141766808 16:86064298-86064320 TCCATGGCCCTGTGGTTCCTGGG + Intergenic
1142622053 17:1171471-1171493 ACAAGGACTCTGAGCTTCCTTGG + Intronic
1142646314 17:1315944-1315966 CCCAGGGCACTGAGGTCTCAGGG + Intergenic
1142713992 17:1738119-1738141 TCCAGGGCACTGATGGTGCTTGG + Exonic
1144864504 17:18326422-18326444 ACCAAAGGAGTGAGGTTCCTGGG - Intergenic
1144952928 17:19003796-19003818 ACCCGGGCTCTGAGGACCCTCGG - Exonic
1146936060 17:36813353-36813375 ACCAGGGTTCTGAGGTTCTGAGG + Intergenic
1147570875 17:41570073-41570095 TCCAGAGCACTGAGGTTCAGGGG + Intronic
1149624053 17:58067103-58067125 TTCAGGGCCCTGAGGTTCCCTGG + Intergenic
1151401154 17:73856985-73857007 TCAAGGGCCCGGAGGTTCCTGGG - Intergenic
1151593818 17:75064577-75064599 ACAAGGAGACTGAGGGTCCTAGG - Exonic
1152003201 17:77660144-77660166 ACCAGGCCACTGAGACTCTTGGG + Intergenic
1152042781 17:77915331-77915353 ACCAAGGGAGTGTGGTTCCTGGG + Intergenic
1153291349 18:3505133-3505155 ACCAGGCCACTGTGCCTCCTGGG + Intronic
1154308945 18:13253001-13253023 ACCGGGGCACTGGGGGTCCAGGG + Intronic
1157503205 18:48205050-48205072 CCCAGGGCCCTGAGGATCCCTGG - Intronic
1158213521 18:55076125-55076147 ACAAGGGCACTGTGGTTCTTAGG + Intergenic
1158445700 18:57518539-57518561 ACCAGGGCCCTAGGGTCCCTTGG - Intergenic
1160115533 18:76075608-76075630 AGCATGGCTCAGAGGTTCCTGGG + Intergenic
1160658867 19:289081-289103 GCCATGGCACTGGGGCTCCTGGG + Intronic
1160823651 19:1069428-1069450 ACCCTGGCACTGTGGTTTCTGGG - Intronic
1162413053 19:10517822-10517844 ACCTGTGAACTGAGCTTCCTGGG + Intronic
1162786516 19:13038360-13038382 AACAGGCCACTGCGGCTCCTGGG + Intronic
1162946418 19:14046591-14046613 AACAGAGCACTGAGGTTCCCAGG - Exonic
1163602487 19:18257447-18257469 GCCAGGGCACTGAGGGCCCCGGG - Exonic
1163628315 19:18403582-18403604 TCCTGGGGACTGAGGGTCCTGGG + Intergenic
1163630850 19:18417368-18417390 ACCAGGGCACACAGGGCCCTGGG + Intergenic
1163791406 19:19308519-19308541 ACCAGGGCACTAGTGTTCATCGG - Intronic
1164526057 19:29014526-29014548 AGGAGGACAGTGAGGTTCCTGGG - Intergenic
1165820959 19:38675791-38675813 GCCTGGGTACGGAGGTTCCTGGG + Intronic
1167296656 19:48654485-48654507 CCCAGGGCACTGAGGAGCCATGG - Intergenic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
927259784 2:21076306-21076328 ATCAGGGAACTGAGGTTTCAGGG - Intergenic
928170347 2:28999312-28999334 GACAAGGCCCTGAGGTTCCTGGG - Exonic
928397198 2:30951862-30951884 ACCCTGGAACTGAAGTTCCTGGG - Intronic
930306971 2:49686663-49686685 TCAAGGTCACTGAGGGTCCTGGG - Intergenic
933164864 2:79064849-79064871 ACCAGGGCACATTTGTTCCTGGG + Intergenic
933586103 2:84180878-84180900 TCCAGTGCACTGAGGTTTCTGGG + Intergenic
935696588 2:105776144-105776166 GGCAGAGCACTGAGATTCCTAGG - Intronic
936431252 2:112465494-112465516 ACCAGGCTACTGAGGCTACTGGG + Intergenic
937288791 2:120769409-120769431 CACAGGGCACTGAGGTTCAGGGG - Intronic
938388304 2:130883334-130883356 GGCAGGGCCCTGAGGTCCCTGGG + Intronic
948149401 2:235733080-235733102 ACCAGGGCTCTGCTCTTCCTGGG + Intronic
1169296596 20:4405283-4405305 ACCAGGAGAATGAGATTCCTGGG - Intergenic
1172092270 20:32441799-32441821 ACCAGAGCACTGAGATTCCCAGG - Intergenic
1172828487 20:37811203-37811225 AATAGGGACCTGAGGTTCCTTGG - Intronic
1175503285 20:59465337-59465359 ACCAGGGCTCTGGGGTCCCAGGG - Intergenic
1175515464 20:59567223-59567245 CCCAGGGCAGTGTGGCTCCTTGG + Intergenic
1175733641 20:61370952-61370974 CCCAGAGCGCTGAGGCTCCTCGG - Intronic
1175810082 20:61853148-61853170 ACCCGGGCACTGGGAGTCCTGGG + Intronic
1176055365 20:63142858-63142880 CCTAAGGCACTGAGGGTCCTGGG + Intergenic
1176084762 20:63290885-63290907 CCCAGAGCACTGAGGCTTCTCGG + Intergenic
1178147943 21:29761177-29761199 ACAGGGGCACTGTGGCTCCTAGG - Intronic
1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG + Intergenic
1181258306 22:21578886-21578908 ATCAGGGCACTGAGGCTCAAAGG - Intronic
1181494876 22:23282155-23282177 CCCAGGACACTGAGGTCCTTCGG - Intronic
1185150941 22:49163700-49163722 ACCTGGGCACTGGAGTTCTTGGG + Intergenic
950102396 3:10366053-10366075 AGCAGGGCACTGAGGTCCGGAGG - Intronic
952838866 3:37627646-37627668 CCTAGGGAACTGAGGTTCATAGG + Intronic
952904970 3:38133870-38133892 ACCTGCACACTGAGTTTCCTGGG + Intronic
954131901 3:48565119-48565141 ACCAGGACCCTGAAGCTCCTTGG - Exonic
954638742 3:52085556-52085578 GCCAGGGCAAGGAGGCTCCTAGG - Intronic
956424770 3:69122527-69122549 AGCAAACCACTGAGGTTCCTGGG - Exonic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961050012 3:123737979-123738001 AACAGGGCAGTGAGGATCCTAGG - Intronic
962936776 3:140088663-140088685 TCCATGTCACTGAGGTTCCTCGG + Intronic
963938501 3:151078081-151078103 ACCAGGTGGCTGAGGTTCCAGGG + Intergenic
964667577 3:159191042-159191064 TCAAGGGCACTGAGATTCCTGGG - Intronic
967123008 3:186400286-186400308 ACTTGGGCACTGAGGTTGCAGGG + Intergenic
970293756 4:14605537-14605559 ACCAAGGTACTGGGCTTCCTGGG - Intergenic
971057967 4:22934966-22934988 ATCATGGCAGTGAGGTTGCTGGG + Intergenic
976082142 4:81367618-81367640 ACCAGGCAACTGAGGTTCAGAGG - Intergenic
980759018 4:137203656-137203678 ACAAGCACACTGAGGTTCCAAGG - Intergenic
980897463 4:138873943-138873965 ACGAGGGGACTGAGGTACTTAGG + Intergenic
985383378 4:189419429-189419451 TCCAGAGCATTGAGGTCCCTTGG + Intergenic
986465732 5:8021133-8021155 ACCATGGCACAACGGTTCCTTGG + Intergenic
986566311 5:9118720-9118742 AGCACAGCACAGAGGTTCCTGGG + Intronic
987127382 5:14827077-14827099 CCCAGGTCGGTGAGGTTCCTTGG - Intronic
990203942 5:53409238-53409260 GCCAGAGCACTGAGGTTTATTGG - Intergenic
997510159 5:134448462-134448484 ACCAGGAGACAGAGATTCCTGGG - Intergenic
1003407034 6:5834286-5834308 CCCAGGCCACCGAGGCTCCTCGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1010309764 6:74371297-74371319 ACCAAGGAACCGAGGTTCCCTGG + Intergenic
1022319902 7:29278713-29278735 AGCAGGGCACTGGGGTCCCTCGG - Intronic
1022463138 7:30630968-30630990 ACTTGGTCACTGAGGTTCATAGG + Intronic
1024004127 7:45212789-45212811 GCCTGGGCACTGAGGTGCCATGG - Intergenic
1025144413 7:56492137-56492159 AAGAGGGGACTGAGCTTCCTGGG - Intergenic
1025260017 7:57412615-57412637 AACAGGGGACTGAACTTCCTGGG - Intergenic
1027664750 7:81031566-81031588 TGCAGGGCACCGAGTTTCCTGGG + Intergenic
1028231330 7:88309716-88309738 ACCAGGTCACTCTGGTTTCTAGG + Intergenic
1028851333 7:95541544-95541566 ACCAGGTCCCTGACCTTCCTGGG + Intergenic
1032463001 7:132125758-132125780 GCCAGGGCACGGAGCTGCCTGGG + Exonic
1035028667 7:155843683-155843705 GCCAGGGCTGTGGGGTTCCTGGG + Intergenic
1035033874 7:155882642-155882664 TCCTGGGCCCTGAGTTTCCTGGG - Intergenic
1035297624 7:157876150-157876172 TCCAGGGCACTGAGGTCTCGTGG - Intronic
1036044712 8:5126907-5126929 ACCAGGTCACTGAGGTCCTGTGG + Intergenic
1040627576 8:49168162-49168184 ACCAGCTCACTGTGGATCCTGGG - Intergenic
1042657467 8:71115591-71115613 ACCAGGTCAGTGAGCTTCCCTGG - Intergenic
1046014201 8:108586434-108586456 ACCAGGGCACTGAGCATCTCTGG - Intergenic
1048848967 8:138626404-138626426 CCCAAGGCAGTGAGGTTCCCTGG + Intronic
1048954641 8:139525823-139525845 TCCAAGGCCCTGAGGTTGCTAGG + Intergenic
1050965092 9:11789571-11789593 ACGACGGCAGTGAAGTTCCTGGG + Intergenic
1053873024 9:42513640-42513662 ACCAGGGAACTGAGGCTCTCAGG + Intergenic
1053899728 9:42782280-42782302 ACCAGGGAACTGAGGCTCTCAGG - Intergenic
1054269306 9:62953112-62953134 ACCAGGGAACTGAGGCTCTCAGG - Intergenic
1056021158 9:82439792-82439814 AGCAGGGCACTGACGTTGCTTGG - Intergenic
1057441608 9:95087743-95087765 AGCTGGGCACTGAGCTTCCTTGG + Intergenic
1057936080 9:99239951-99239973 ACCAGGGAACTGAGGTTCAGAGG - Intergenic
1058456582 9:105143389-105143411 ACTAGGGCTCTGAGGTTTTTTGG + Intergenic
1061144742 9:128791083-128791105 ACCAGGACACTGGGCTTCCATGG - Intronic
1061851609 9:133419191-133419213 AACAGGGAAGTGAGGCTCCTAGG + Intronic
1061872688 9:133529124-133529146 ACGAGGACACTGAGGCTCCCAGG - Intergenic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1062662940 9:137648886-137648908 AGCAGGGCACTGTGGTGGCTTGG - Intronic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1186436885 X:9550815-9550837 ACCAGGGCAGTTGTGTTCCTTGG + Intronic
1190687797 X:52889857-52889879 ACCAGGGCACAGGGGATCCCGGG - Intergenic
1190698185 X:52965935-52965957 ACCAGGGCACAGGGGATCCCGGG + Intronic
1191800998 X:65079285-65079307 TTCAGGGCAGTGAGGTCCCTCGG - Intergenic
1194063929 X:89238992-89239014 ACCAGGGCACTGATATCCATAGG - Intergenic
1195916184 X:109938276-109938298 TCCTGGGCACTGAGGATCCACGG - Intergenic
1196756044 X:119158255-119158277 AGCAGGGCACTGAGGCTAATGGG + Intergenic
1197709045 X:129653406-129653428 GGCAGGGCAGTGAGTTTCCTGGG - Intronic
1197958695 X:131980431-131980453 AAGAGAGAACTGAGGTTCCTGGG - Intergenic
1199676541 X:150194534-150194556 ACCTGGGAGCTGAGGTTCCTGGG - Intergenic
1200084507 X:153597081-153597103 ACCAGGGCAGTGATTTTCTTAGG - Intronic
1200718103 Y:6573097-6573119 ACCAGGGCACTGATATCCATAGG - Intergenic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic