ID: 1080664673

View in Genome Browser
Species Human (GRCh38)
Location 11:34325252-34325274
Sequence CCATCAGTGGCCACTATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080664670_1080664673 -10 Left 1080664670 11:34325239-34325261 CCTCTTTAGTGGTCCATCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1080664673 11:34325252-34325274 CCATCAGTGGCCACTATCAGAGG 0: 1
1: 0
2: 1
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080664673 Original CRISPR CCATCAGTGGCCACTATCAG AGG Intronic
900509716 1:3052820-3052842 CCATCTGTGGCGAGGATCAGGGG - Intergenic
901625416 1:10621983-10622005 CCTTCAGTGGGCACTGCCAGAGG - Intronic
901693565 1:10990221-10990243 CCATGAGTGGCCATGACCAGGGG + Intergenic
906401203 1:45506077-45506099 TCATCAGGGGAAACTATCAGTGG - Intronic
906780809 1:48571499-48571521 TCATCAGGGGACACTATGAGAGG + Intronic
913080186 1:115377171-115377193 CAATTAGAAGCCACTATCAGCGG + Intergenic
916728188 1:167542720-167542742 CCAGCTGTGGTCACTATCACTGG - Intronic
919818297 1:201455917-201455939 CCAGCAGTGGGCACTAGCAGAGG + Intergenic
920122869 1:203671995-203672017 CCACCAGCTGCCACTATCAAGGG - Intronic
920552214 1:206872008-206872030 GCAGCTCTGGCCACTATCAGAGG + Intergenic
924183059 1:241458573-241458595 CCATCTGGGGCCACTCTCTGTGG - Intergenic
1069399963 10:68033668-68033690 CCATTATTGGCCACTGTTAGTGG - Intronic
1069609947 10:69766321-69766343 CCACCAGTGGCCACAACCAGGGG - Intergenic
1070623228 10:78029903-78029925 CCAACAGAGGGCACTATCTGTGG + Intergenic
1075436426 10:122447080-122447102 CTATCAGTGGAAACTGTCAGAGG - Intergenic
1076477929 10:130765601-130765623 CAATCTGTGGCCAGTATCAAGGG - Intergenic
1077158052 11:1100164-1100186 CCAGCACTGGCCAGTGTCAGTGG - Intergenic
1080664673 11:34325252-34325274 CCATCAGTGGCCACTATCAGAGG + Intronic
1083596533 11:63920508-63920530 CCATCAGTGGCCACAGCCAAGGG + Intergenic
1084496653 11:69509113-69509135 CCATCAGTGTCCCCAATCTGCGG - Intergenic
1086761695 11:90639245-90639267 TCATCAGTGCTCACTATGAGGGG - Intergenic
1088065113 11:105708076-105708098 CCATCAGTTACCAGTTTCAGTGG + Intronic
1088812353 11:113400214-113400236 CCGTCAGTGGCCACTCTGGGTGG + Exonic
1104138307 12:125961442-125961464 CCATCAGGGGCAACTGTAAGAGG + Intergenic
1105568400 13:21575219-21575241 AGAACAGTGGCCACTGTCAGGGG + Intronic
1108069030 13:46608352-46608374 CCATCAGTGGAAACTATGATGGG - Intronic
1108297375 13:49037817-49037839 CCATCTGTAGACACTATCATGGG - Intronic
1111399015 13:87707788-87707810 GCATCACAGGACACTATCAGTGG - Intergenic
1116360082 14:43983245-43983267 CTAACAGTGGCCACTATAGGAGG + Intergenic
1120896417 14:89536884-89536906 TCATCAGTGGCCCCCATCACCGG + Intronic
1122048658 14:99040793-99040815 CCATCAGTGGCCAGAGGCAGAGG + Intergenic
1127932235 15:63604536-63604558 CCATCAGTGCCCACCTTCTGGGG - Intergenic
1128185660 15:65641731-65641753 TCATCAGTGGCTACTCCCAGAGG + Intronic
1131520527 15:93110763-93110785 CCTTCCGTGGCCATTGTCAGGGG + Intergenic
1137030534 16:35519696-35519718 GGATCAGTGGCCCCTATCACAGG + Intergenic
1143120413 17:4603089-4603111 CCACCAGGGGTCATTATCAGAGG + Intronic
1145014435 17:19387302-19387324 GCATCAGTTTACACTATCAGGGG + Intergenic
1149574210 17:57699887-57699909 ACATCAGTGGGCACTCTCTGAGG + Intergenic
1150597335 17:66617629-66617651 CCATTTGTGGCCACAGTCAGTGG - Intronic
1152245942 17:79184604-79184626 CTGCCAGTGGCCACTGTCAGAGG + Intronic
1155042492 18:22076288-22076310 CCATGAGGGGCCAGTCTCAGTGG - Intergenic
1160011704 18:75111151-75111173 CCATCAGTGTCCTCTAGCTGGGG - Intergenic
1163361057 19:16846732-16846754 CCAGCAGTGTCCACGAACAGAGG - Intronic
1164014056 19:21236278-21236300 GGATCAGTGGCCCCTATCACAGG + Intronic
1164569781 19:29364908-29364930 ACATCCGTGGCCACCCTCAGTGG - Intergenic
1165425443 19:35742929-35742951 ACCTCAGTGGCCAGTATCAGGGG + Intronic
1165425449 19:35742952-35742974 AACTCAGTGGCCAGTATCAGGGG + Intronic
925640029 2:5978500-5978522 GCATCAGTGGTCAGTATCTGAGG + Intergenic
928267300 2:29822519-29822541 CCAGCAGTGGCTATGATCAGTGG + Intronic
929755241 2:44758752-44758774 ACAGCAGTGTCCAGTATCAGAGG + Intronic
933419311 2:82026195-82026217 CAATCAGTGGCCACTTTCTCAGG + Intergenic
934602914 2:95671859-95671881 CCATCAGTGGCAATAATCAGTGG + Intergenic
936536299 2:113314056-113314078 CCATCAGTGGCAATAATCAGTGG + Intergenic
937973938 2:127569848-127569870 CCATCAGTGGCCAGCATTCGTGG + Exonic
939517187 2:143183466-143183488 GCATCAGTGGGCACCATCAGAGG + Intronic
944890378 2:204110922-204110944 CCATATGTGGCCACTAACATAGG - Intergenic
945553543 2:211251129-211251151 CCTGCAGTGGCCACTTTCACTGG - Intergenic
948818046 2:240523555-240523577 TCAGCAGGGGCCACTGTCAGGGG - Intronic
1170648764 20:18220017-18220039 CCATCACTGGCCAGGATCACGGG + Intergenic
1172652412 20:36513169-36513191 CCATCAGAGGCCATTATTAAAGG + Intronic
1172881652 20:38203663-38203685 CCCTCAGGGTCCCCTATCAGAGG - Intergenic
1173912842 20:46683130-46683152 GTATCAGTGGCCAGTAGCAGTGG - Intronic
1176932622 21:14831135-14831157 AAACCAGTAGCCACTATCAGTGG + Intergenic
1178832474 21:36068380-36068402 CCATAGGTTGCCACTATCACAGG - Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1183490527 22:38113286-38113308 CCCTCAGTGACCACCAGCAGGGG - Intronic
1185406984 22:50657998-50658020 CCATGTGTGGCCACTTTGAGTGG - Intergenic
949576295 3:5342067-5342089 CCATCAGAGGCCACTTCCAAAGG + Intergenic
949834674 3:8255007-8255029 CCACCAGTGTCCACTCTAAGGGG - Intergenic
953117832 3:40010304-40010326 CCCTCAGCTGCCACTCTCAGAGG - Intronic
953401543 3:42625295-42625317 CTGTCACTGGCCACTGTCAGTGG + Intronic
954196970 3:49002708-49002730 CCATCTCTGGCCACTATAAAGGG - Intronic
959141488 3:102491869-102491891 CCAGCAGTGGCAACTCTCTGGGG - Intergenic
961677918 3:128578810-128578832 CCCTCAGTGTCCACTCACAGAGG + Intergenic
962220403 3:133560086-133560108 CCACCAGAGGACACTAGCAGAGG + Intergenic
962310897 3:134326190-134326212 CCAGCTGTGGCCACTTCCAGAGG + Intergenic
962421872 3:135235955-135235977 CCATCACGGGCTACTATTAGGGG - Intronic
962853132 3:139322806-139322828 CCATGACTGGTCACTGTCAGAGG - Intronic
968343803 3:197982932-197982954 CCCTCAGTGGACACTGTCGGAGG + Intronic
970111226 4:12640040-12640062 CAGTCACTGGCCCCTATCAGAGG + Intergenic
970856096 4:20651000-20651022 CCATCAGTCCACACTGTCAGTGG - Intergenic
971096385 4:23409316-23409338 CCATCCATGGCCACTGTCTGAGG - Intergenic
974446118 4:61984417-61984439 CCATCAGTGGCCAGACACAGTGG + Intronic
976767287 4:88610564-88610586 CCATCACTGGCTACCGTCAGAGG - Intronic
977470247 4:97434367-97434389 CCATCACTGGCCAGTTGCAGTGG - Intronic
977708263 4:100095413-100095435 ACATCAATGGCCACTTTCAAAGG + Intergenic
980920225 4:139077934-139077956 CCAGCAATAGCCACTACCAGTGG - Intronic
985036551 4:185846232-185846254 CCATTTGTTGCAACTATCAGTGG - Intronic
1002965655 6:1963761-1963783 TGCTCAGTGGCCACTACCAGTGG - Intronic
1005757200 6:28935488-28935510 CCATCAGTATCCACTCCCAGAGG + Intergenic
1011419656 6:87157512-87157534 CTATCAGTGGACACTATTAGGGG - Intronic
1016408814 6:143760502-143760524 CCAGCAGTGGCCCCTTTCGGAGG - Exonic
1019922441 7:4171647-4171669 CCTTCACTGGCCACCACCAGTGG - Intronic
1024507387 7:50173638-50173660 CCATCCGTGGACAGCATCAGAGG - Intergenic
1029233759 7:99094941-99094963 CCATCAATGGCCACTATCACAGG + Intronic
1035760193 8:2063239-2063261 CGATCTGTGGCCATTTTCAGTGG + Intronic
1041402223 8:57457802-57457824 ACAACAGTGGCCATTATCAGAGG - Intergenic
1048223636 8:132565200-132565222 TCCTCAGTGGTCACTGTCAGTGG + Intergenic
1050290145 9:4145643-4145665 ACATCAGTGCCCTCTGTCAGAGG + Intronic
1051354576 9:16230208-16230230 CCATCAGTGGACATTTACAGAGG - Intronic
1056782341 9:89560263-89560285 CCTTCCCTGCCCACTATCAGAGG - Intergenic
1200166055 X:154036168-154036190 CCATGAGAGGCCTCTAGCAGTGG + Intronic
1201628305 Y:16039600-16039622 CCATCACTGGCCAACATCAAGGG + Intergenic