ID: 1080668965

View in Genome Browser
Species Human (GRCh38)
Location 11:34358548-34358570
Sequence GGCTGTGTTTGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080668955_1080668965 3 Left 1080668955 11:34358522-34358544 CCTCCCGCAATCCGAGATGAAAC No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668952_1080668965 10 Left 1080668952 11:34358515-34358537 CCAGGCCCCTCCCGCAATCCGAG No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668957_1080668965 -1 Left 1080668957 11:34358526-34358548 CCGCAATCCGAGATGAAACGCTG No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668959_1080668965 -8 Left 1080668959 11:34358533-34358555 CCGAGATGAAACGCTGGCTGTGT No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668954_1080668965 4 Left 1080668954 11:34358521-34358543 CCCTCCCGCAATCCGAGATGAAA No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668948_1080668965 23 Left 1080668948 11:34358502-34358524 CCTCCACCTTCCGCCAGGCCCCT No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668953_1080668965 5 Left 1080668953 11:34358520-34358542 CCCCTCCCGCAATCCGAGATGAA No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668951_1080668965 13 Left 1080668951 11:34358512-34358534 CCGCCAGGCCCCTCCCGCAATCC No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668946_1080668965 28 Left 1080668946 11:34358497-34358519 CCTCTCCTCCACCTTCCGCCAGG No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668956_1080668965 0 Left 1080668956 11:34358525-34358547 CCCGCAATCCGAGATGAAACGCT No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668950_1080668965 17 Left 1080668950 11:34358508-34358530 CCTTCCGCCAGGCCCCTCCCGCA No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data
1080668949_1080668965 20 Left 1080668949 11:34358505-34358527 CCACCTTCCGCCAGGCCCCTCCC No data
Right 1080668965 11:34358548-34358570 GGCTGTGTTTGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080668965 Original CRISPR GGCTGTGTTTGGAGGGAGGA GGG Intergenic
No off target data available for this crispr