ID: 1080669072

View in Genome Browser
Species Human (GRCh38)
Location 11:34359122-34359144
Sequence GAGTAGCCACAGGGCAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080669072_1080669076 -3 Left 1080669072 11:34359122-34359144 CCGCCGCTGCCCTGTGGCTACTC No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669072_1080669077 17 Left 1080669072 11:34359122-34359144 CCGCCGCTGCCCTGTGGCTACTC No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data
1080669072_1080669079 26 Left 1080669072 11:34359122-34359144 CCGCCGCTGCCCTGTGGCTACTC No data
Right 1080669079 11:34359171-34359193 GCCCCCTCCAGTGGAACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080669072 Original CRISPR GAGTAGCCACAGGGCAGCGG CGG (reversed) Intergenic
No off target data available for this crispr