ID: 1080669076

View in Genome Browser
Species Human (GRCh38)
Location 11:34359142-34359164
Sequence CTCACACGCACGTGCGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080669068_1080669076 14 Left 1080669068 11:34359105-34359127 CCCGGTGCAGGCATGTCCCGCCG No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669069_1080669076 13 Left 1080669069 11:34359106-34359128 CCGGTGCAGGCATGTCCCGCCGC No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669067_1080669076 19 Left 1080669067 11:34359100-34359122 CCATGCCCGGTGCAGGCATGTCC No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669073_1080669076 -6 Left 1080669073 11:34359125-34359147 CCGCTGCCCTGTGGCTACTCACA No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669071_1080669076 -2 Left 1080669071 11:34359121-34359143 CCCGCCGCTGCCCTGTGGCTACT No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669072_1080669076 -3 Left 1080669072 11:34359122-34359144 CCGCCGCTGCCCTGTGGCTACTC No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data
1080669066_1080669076 20 Left 1080669066 11:34359099-34359121 CCCATGCCCGGTGCAGGCATGTC No data
Right 1080669076 11:34359142-34359164 CTCACACGCACGTGCGCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080669076 Original CRISPR CTCACACGCACGTGCGCAAA CGG Intergenic
No off target data available for this crispr