ID: 1080669077

View in Genome Browser
Species Human (GRCh38)
Location 11:34359162-34359184
Sequence CGGACCTGTGCCCCCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080669072_1080669077 17 Left 1080669072 11:34359122-34359144 CCGCCGCTGCCCTGTGGCTACTC No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data
1080669074_1080669077 8 Left 1080669074 11:34359131-34359153 CCCTGTGGCTACTCACACGCACG No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data
1080669075_1080669077 7 Left 1080669075 11:34359132-34359154 CCTGTGGCTACTCACACGCACGT No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data
1080669073_1080669077 14 Left 1080669073 11:34359125-34359147 CCGCTGCCCTGTGGCTACTCACA No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data
1080669071_1080669077 18 Left 1080669071 11:34359121-34359143 CCCGCCGCTGCCCTGTGGCTACT No data
Right 1080669077 11:34359162-34359184 CGGACCTGTGCCCCCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080669077 Original CRISPR CGGACCTGTGCCCCCTCCAG TGG Intergenic
No off target data available for this crispr