ID: 1080674494

View in Genome Browser
Species Human (GRCh38)
Location 11:34412251-34412273
Sequence TTTCAAATACTGCTAGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080674494_1080674496 -6 Left 1080674494 11:34412251-34412273 CCAACTACTAGCAGTATTTGAAA No data
Right 1080674496 11:34412268-34412290 TTGAAATTAGTGTTGAACCAGGG No data
1080674494_1080674495 -7 Left 1080674494 11:34412251-34412273 CCAACTACTAGCAGTATTTGAAA No data
Right 1080674495 11:34412267-34412289 TTTGAAATTAGTGTTGAACCAGG No data
1080674494_1080674497 2 Left 1080674494 11:34412251-34412273 CCAACTACTAGCAGTATTTGAAA No data
Right 1080674497 11:34412276-34412298 AGTGTTGAACCAGGGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080674494 Original CRISPR TTTCAAATACTGCTAGTAGT TGG (reversed) Intergenic
No off target data available for this crispr