ID: 1080676857

View in Genome Browser
Species Human (GRCh38)
Location 11:34435891-34435913
Sequence CCATAGCATGAGCTATGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676857_1080676859 -3 Left 1080676857 11:34435891-34435913 CCTTAGCATAGCTCATGCTATGG No data
Right 1080676859 11:34435911-34435933 TGGCCATCACCAGACACCAGAGG No data
1080676857_1080676861 5 Left 1080676857 11:34435891-34435913 CCTTAGCATAGCTCATGCTATGG No data
Right 1080676861 11:34435919-34435941 ACCAGACACCAGAGGACATCTGG No data
1080676857_1080676863 6 Left 1080676857 11:34435891-34435913 CCTTAGCATAGCTCATGCTATGG No data
Right 1080676863 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
1080676857_1080676865 25 Left 1080676857 11:34435891-34435913 CCTTAGCATAGCTCATGCTATGG No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676857 Original CRISPR CCATAGCATGAGCTATGCTA AGG (reversed) Intergenic
No off target data available for this crispr