ID: 1080676860

View in Genome Browser
Species Human (GRCh38)
Location 11:34435914-34435936
Sequence TGTCCTCTGGTGTCTGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676860_1080676865 2 Left 1080676860 11:34435914-34435936 CCATCACCAGACACCAGAGGACA No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data
1080676860_1080676871 24 Left 1080676860 11:34435914-34435936 CCATCACCAGACACCAGAGGACA No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676860_1080676870 23 Left 1080676860 11:34435914-34435936 CCATCACCAGACACCAGAGGACA No data
Right 1080676870 11:34435960-34435982 GGCAATTATTCATATTAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676860 Original CRISPR TGTCCTCTGGTGTCTGGTGA TGG (reversed) Intergenic
No off target data available for this crispr