ID: 1080676862

View in Genome Browser
Species Human (GRCh38)
Location 11:34435920-34435942
Sequence CCCAGATGTCCTCTGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676862_1080676871 18 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676862_1080676872 28 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676862_1080676865 -4 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data
1080676862_1080676870 17 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676870 11:34435960-34435982 GGCAATTATTCATATTAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676862 Original CRISPR CCCAGATGTCCTCTGGTGTC TGG (reversed) Intergenic