ID: 1080676864

View in Genome Browser
Species Human (GRCh38)
Location 11:34435927-34435949
Sequence GAGGCAACCCAGATGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676864_1080676871 11 Left 1080676864 11:34435927-34435949 CCAGAGGACATCTGGGTTGCCTC No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data
1080676864_1080676870 10 Left 1080676864 11:34435927-34435949 CCAGAGGACATCTGGGTTGCCTC No data
Right 1080676870 11:34435960-34435982 GGCAATTATTCATATTAAAGCGG No data
1080676864_1080676872 21 Left 1080676864 11:34435927-34435949 CCAGAGGACATCTGGGTTGCCTC No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676864 Original CRISPR GAGGCAACCCAGATGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr