ID: 1080676865

View in Genome Browser
Species Human (GRCh38)
Location 11:34435939-34435961
Sequence TGGGTTGCCTCCTCCCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676862_1080676865 -4 Left 1080676862 11:34435920-34435942 CCAGACACCAGAGGACATCTGGG No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data
1080676860_1080676865 2 Left 1080676860 11:34435914-34435936 CCATCACCAGACACCAGAGGACA No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data
1080676857_1080676865 25 Left 1080676857 11:34435891-34435913 CCTTAGCATAGCTCATGCTATGG No data
Right 1080676865 11:34435939-34435961 TGGGTTGCCTCCTCCCAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676865 Original CRISPR TGGGTTGCCTCCTCCCAAGT AGG Intergenic
No off target data available for this crispr