ID: 1080676866

View in Genome Browser
Species Human (GRCh38)
Location 11:34435946-34435968
Sequence ATAATTGCCTACTTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676866_1080676873 16 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676873 11:34435985-34436007 AAGATATGGTGCAGCCAAATAGG No data
1080676866_1080676872 2 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676866_1080676874 28 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676866_1080676870 -9 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676870 11:34435960-34435982 GGCAATTATTCATATTAAAGCGG No data
1080676866_1080676871 -8 Left 1080676866 11:34435946-34435968 CCTCCTCCCAAGTAGGCAATTAT No data
Right 1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676866 Original CRISPR ATAATTGCCTACTTGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr