ID: 1080676868

View in Genome Browser
Species Human (GRCh38)
Location 11:34435952-34435974
Sequence ATATGAATAATTGCCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676868_1080676874 22 Left 1080676868 11:34435952-34435974 CCCAAGTAGGCAATTATTCATAT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676868_1080676873 10 Left 1080676868 11:34435952-34435974 CCCAAGTAGGCAATTATTCATAT No data
Right 1080676873 11:34435985-34436007 AAGATATGGTGCAGCCAAATAGG No data
1080676868_1080676872 -4 Left 1080676868 11:34435952-34435974 CCCAAGTAGGCAATTATTCATAT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676868 Original CRISPR ATATGAATAATTGCCTACTT GGG (reversed) Intergenic
No off target data available for this crispr