ID: 1080676869

View in Genome Browser
Species Human (GRCh38)
Location 11:34435953-34435975
Sequence AATATGAATAATTGCCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080676869_1080676874 21 Left 1080676869 11:34435953-34435975 CCAAGTAGGCAATTATTCATATT No data
Right 1080676874 11:34435997-34436019 AGCCAAATAGGCAGAGCAGAAGG No data
1080676869_1080676872 -5 Left 1080676869 11:34435953-34435975 CCAAGTAGGCAATTATTCATATT No data
Right 1080676872 11:34435971-34435993 ATATTAAAGCGGGAAAGATATGG No data
1080676869_1080676873 9 Left 1080676869 11:34435953-34435975 CCAAGTAGGCAATTATTCATATT No data
Right 1080676873 11:34435985-34436007 AAGATATGGTGCAGCCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080676869 Original CRISPR AATATGAATAATTGCCTACT TGG (reversed) Intergenic
No off target data available for this crispr